boswellia serrata for arthritis relief a journey from frankincense to aflapin and 5 loxin
a journey from robot to digital human
... joint accelerations of the neck vs time under an initial normal posture XXI 54 7 54 7 54 8 54 8 54 9 54 9 55 0 55 0 55 1 55 2 55 2 55 3 55 3 55 4 55 6 55 7 55 7 55 8 55 8 55 9 55 9 56 0 ... as artificial ears and eyes Ten years later, they created a new Wabot-2 as a musician humanoid robot that was able to communicate with a person, read a normal musical score by his eyes and play ... local and global kinematics and statics of a digital human in Chapter 9, and creating parts and then assembling them together to build a 3D mannequin in MATLABT M as well as to drive the mannequin...
- 600
- 528
- 0
BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc
... filesystem • 5: 00am: A batch job generates and sends yesterday's sales report to the accounting department • 5: 15am: Another batch job generates and sends a stock on hand report to the warehouse and purchasing ... Fortune 50 0 companies to government organizations In recent years, Qiang has travelled hundreds thousands of miles around Australia and the North AP area to help many organizations to design, manage, ... administration tasks Stop/start components 2 85 288 288 Defining additional GUI users and groups 298 When to apply fix packs and patches How to apply fix packs and patches Fix pack and patch installations...
- 534
- 1,736
- 0
Tiêu chuẩn ASTM A 962: Standard Specification for Common Requirements for Steel Fasteners or Fastener Materials, or Both, Intended for Use at Any Temperature from Cryogenic to the Creep Range
... Specifications A 29 /A 29M or A 484 /A 484M as applicable 19.2 Grade and manufacturer’s identification symbols shall be applied to one end of studs 3⁄8 in [10 mm] in diameter and larger and to the heads ... material from externally threaded fasteners when the thread diameter is 1⁄2 in and under Materials and Manufacture 6.1 Bars shall be produced in accordance with Specifications A 29 /A 29M or A 484 /A ... specification Chemical Composition 7.1 Chemical Analysis—Heat or product chemical analysis shall be in accordance with Test Methods, Practices, and Terminology A 751 7.2 Heat Analysis—An analysis...
- 8
- 864
- 1
Parallel Worlds: A Journey Through Creation, Higher Dimensions, and the Future of the Cosmos
... particles called atoms Today, with our powerful atom smashers and particle accelerators, we can break apart the atom itself into electrons and nuclei, which in turn can be broken into even smaller ... WMAP satellite was first proposed to NASA in 19 95 and was approved two years later On June 30, 2001, NASA sent the WMAP satellite aboard a Delta II rocket into a solar orbit perched between Earth ... has weight, surrounds the galaxies in a gigantic halo, but is totally invisible Dark matter is so pervasive and abundant that, in our own Milky Way galaxy, it outweighs all the stars by a factor...
- 447
- 477
- 0
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... book is an all-in-one-place handbook for those managers and members of the marketing team who need to collect and assess information, create and communicate market-led strategies, take strategic ... and Charles Handy that strategic thinking involves ethical and moral reasoning We are grateful to Routledge for permission to use material from A Thoughtful Approach to the Practice of Management...
- 159
- 1,243
- 0
American Public Support for U.S. Military Operations from Mogadishu to Baghdad - Technical Appendixes ppt
... final stages of the U.S military intervention in Somalia, the peace operations in Haiti, Bosnia, and Kosovo, the war against the Taliban and Al Qaeda in Afghanistan, and the overthrow of Saddam ... casualties, a striking contrast to the results for Somalia, Haiti, Bosnia, and, to an extent, Kosovo Statistical Results for Afghanistan Table E.10 Marginal Probability from the Probit Estimates ... also are good 6 American Public Support for U.S Military Operations from Mogadishu to Baghdad: Technical Appendixes Table A. 5 Marginal Probability from Probit Estimates of Escalation (Q8) Variables...
- 70
- 258
- 0
A Cognitive Strategies Approach to Reading and Writing Instruction for English Language Learners in Secondary School pdf
... served as the basis for Pathway curriculum, was fluid and recursive rather than linear We introduced Pathway teachers to the idea of a tool kit and to a variety of curricular approaches to strategy ... speak English as a second language and face a number of educational challenges Many teachers of struggling students and English language learners (ELLs) avoid teaching strategic reading and analytical ... APPLEBEE, A N., & LANGER, J A (1983) Instructional scaffolding: Reading and writing as natural language activities Language Arts, 60, 1 65- 1 75 2/2/07, 11:22 AM OLSON AND L AND A Cognitive Strategies...
- 35
- 818
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... the poneratoxin gene [11] Two oligonucleotides: forward 5 -GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5 -CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used to synthesize ... N-terminal fragment of the poneratoxin gene Two others: forward 5 -GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5 -AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were used to ... the 5 signal peptide sequence: 5 -GAATTCATGCTACTAGTAAAT CAG-3¢ (number 1) and downstream primer with a sequence complementary to the 5 end of poneratoxin gene and 3¢ end of a signal peptide: 5 -CAGAAGCGGAA...
- 10
- 696
- 0
Báo cáo khoa học: "Wrapping up a Summary: from Representation to Generation" pot
... and Scalable Text Summarization at the Annual Joint Meeting of the ACL/EACL, Madrid K Sp¨ rck-Jones 1999 Automatic summarising: Faca tors and directions In I Mani and M Maybury, editors, Advances ... sentences For example: Three-fold Summarization: Interpretation, Transformation and Generation We chose the LSA paradigm for summarization, since it provides a clear and direct instantiation of ... Advances in Automatic Text Summarization MIT Press P Brown, S Della Pietra, V Della Pietra, and R Mercer 1994 The mathematic of statistical machine translation: Parameter estimation Computational Linguistics,...
- 5
- 229
- 0
Báo cáo khoa học: "Models for Sentence Compression: A Comparison across Domains, Training Requirements and Evaluation Measures" docx
... grateful to our annotators Vasilis Karaiskos, Beata Kouchnir, and Sarah Luger Thanks to Jean Carletta, Frank Keller, Steve Renals, and Sebastian Riedel for helpful comments and suggestions Lapata ... consists of 26, 151 tokens.3 The Robust Accurate Statistical Parsing (RASP) toolkit (Briscoe and Carroll 2002) was used to automatically tokenise the corpus Each annotator was asked to perform sentence ... text and spontaneous speech as it has been scripted beforehand and is usually read off an autocue One stumbling block to performing a comparative study between written data and speech data is that...
- 8
- 258
- 0
Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx
... AY531048–AY5 31049, AY531 051 –AY531 052 , AY531 054 , AY531 056 – AY531 057 , EU103820–EU103823, EU103631–EU1038 19, N2: AY531006–AY531013, AY5310 15 AY531016, AY531018–AY531020, AY531023, AY531026–AY5310 ... 20 05- 2006 A/ Denmark/22/ 05 2004-20 05 50 A/ Denmark/67/ 05 A/ California/07/ 05 A/ Denmark/84/ 05 92 PA A/ Denmark/67/ 05 2004-20 05 2004-20 05 A/ Denmark/68/ 05 A/ Denmark/ 35/ 06 20 05- 2006 NP A/ California/07/4 99 A/ Denmark/ 35/ 06 ... A/ Denmark/110/ 05 A/ Denmark/116/ 05 A/ Denmark/29/ 05 A/ Denmark/22/ 05 A/ Denmark/ 15/ 04 A/ Denmark/22/ 05 2004-20 05 A/ Denmark /54 / 05 88 A/ Denmark/110/ 05 A/ Denmark/17/04 86 98 A/ Denmark/79/ 05 A/ Denmark/16/04...
- 19
- 579
- 0
Báo cáo lâm nghiệp: "A decision support system to simulate and compare silvicultural scenarios for pure even-aged larch stands" doc
... the stand (in years), a, c, d and p are the fixed parameters of the model, and bi is a variable parameter related to the stand site index (dominant height reached at 50 years) specific to each site ... thinnings that are designed so as to maintain a constant and relatively low basal area after each cycle ( 15 m3 ha−1 ) The rotation of scenario is fixed to 60 years As for scenario 3, the thinnings are ... designed to lead to a fixed remaining stand basal area which in this case is variable from cycle to cycle and is calculated to optimize the biodiversity indicator The particularity of scenario 5, whose...
- 9
- 343
- 0
Beginning SQL Server 2008 for Developers From Novice to Professional phần 5 ppt
... delve a bit deeper into what the SQL Server database diagram is all about The SQL Server Database Diagram Tool Management Studio’s database diagram tool aids in the building of diagrams that detail ... made in the msdb database to retrieve the last backup set that was taken, that we a “restore” of the database as verification only without actually restoring any data, and that the restore can ... on a Saturday evening? That would take one data file and six transaction log file restores to complete Sit down and take stock As often as you can, take a full database backup, then take a differential...
- 45
- 378
- 0
Báo cáo y học: " Avoiding the ‘twilight zone’: Recommendations for the transition of services from adolescence to adulthood for young people with ADHD" pot
... unclear pathways for transition to adult care, have to navigate through a quagmire of healthcare bureaucracy to find appropriate adult healthcare for their adolescent Both child and adult teams ... draft SY, DC and CM made revisions and edits to subsequent drafts All authors read and approved the final manuscript Authors’ information More information about ADHD, educational forums and training ... CPA’s are not available in paediatric practice and so a planned assessment of need with the young person and their parent and a clearly documented plan of action is recommended 15 Parents and carers...
- 8
- 578
- 0
Báo cáo y học: "Insect sting allergy. A study from 1980 to 2003 of patients who started treatment with venom immunotherapy between 1980 and 1998" pps
... done at a laboratory using Pharmacia RAST from 1980 to1 987, CAP from1 988 to1 998 and DCP Alastat from 1999 to 2003 In addition http://www.clinicalmolecularallergy.com/content/3/1/12 analyses of haemoglobin, ... the wheal of the SPT area was 50 % or larger than that caused by histamine and had a minimum diameter of mm larger than the control, it was recorded as positive Serum analyses of total and specific ... following data, age, gender, symptom at inclusion, SPT to inhalant allergens, SPT, RAST and total IgE at five years of treatment, reaction due to incremental IT and duration of IT, to assess the...
- 8
- 363
- 0
Beginning SQL Server 2005 for Developers From Novice to Professional phần 5 doc
... the database owner (see Chapters 1, 2, and ) It is just as important to use a valid database owner and not the sa login when attaching a database as it is when creating a database The database, ... that requires high availability so that the restore takes the least amount of time may be what you need Detaching and Attaching a Database Now that we can back up and restore a database, we have ... that a check is made in the msdb database to retrieve the last backup set that was taken, and we a “restore” of the database as verification only, without actually restoring any data, and that...
- 53
- 321
- 0
Assessment of anaerobic co digestion of agro wastes for biogas recovery a bench scale application to date palm wastes
... Paavola T, Hearen, S, Banks, C, Rintala, J Anaerobic digestion of autoclaved and untreated food waste Waste Manage 34, 370-377 (2014) [10] Chandrasekaran M, Bahkali AH Valorization of date palm (Phoenix ... waste materials is abundantly available in Iraq without proper management and application The average measured values of total solids (TS), volatile solids (VS), and pH for the mixed date palm ... gases was recalculated for standard temperature and pressure (STP: 0oC and bar) according to Hansen et al [13] The other gas measuring approach is the water displacement method in which the gases...
- 10
- 333
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008