average fosc vs vdd for various values of r rc mode c 100 pf 25°c
Tài liệu PIC16F87XA Data Sheet ppt
... 12 RC2 /CCP1 RC2 CCP1 13 RC3 /SCK/SCL RC3 SCK SCL 14 RC4 /SDI/SDA RC4 SDI SDA 15 RC5 /SDO RC5 SDO 16 RC6 /TX/CK RC6 TX CK 17 RC7 /RX/DT RC7 RX DT 18 TTL/ST(2) I/O I Digital I/O In-circuit debugger and ... In-Circuit Debugger MUX ALU PORTC RC0 /T1OSO/T1CKI RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK RC7 /RX/DT W reg Low-Voltage Programming MCLR VDD, VSS Timer0 Timer1 Timer2 ... RD5/PSP5 RD4/PSP4 RC7 /RX/DT RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RD0/PSP0 RD1/PSP1 RD2/PSP2 RD3/PSP3 RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK NC RC6 /TX/CK RC5 /SDO RC4 /SDI/SDA RD3/PSP3 RD2/PSP2 RD1/PSP1 RD0/PSP0...
- 234
- 3,824
- 0
PIC16F877A data sheet
... 12 RC2 /CCP1 RC2 CCP1 13 RC3 /SCK/SCL RC3 SCK SCL 14 RC4 /SDI/SDA RC4 SDI SDA 15 RC5 /SDO RC5 SDO 16 RC6 /TX/CK RC6 TX CK 17 RC7 /RX/DT RC7 RX DT 18 TTL/ST(2) I/O I Digital I/O In-circuit debugger and ... In-Circuit Debugger MUX ALU PORTC RC0 /T1OSO/T1CKI RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK RC7 /RX/DT W reg Low-Voltage Programming MCLR VDD, VSS Timer0 Timer1 Timer2 ... RD5/PSP5 RD4/PSP4 RC7 /RX/DT RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RD0/PSP0 RD1/PSP1 RD2/PSP2 RD3/PSP3 RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK NC RC6 /TX/CK RC5 /SDO RC4 /SDI/SDA RD3/PSP3 RD2/PSP2 RD1/PSP1 RD0/PSP0...
- 234
- 1,192
- 0
PIC16F87XA Data Sheet28/40/44-Pin Enhanced Flash Microcontrollers 2003 Microchip Technology doc
... 12 RC2 /CCP1 RC2 CCP1 13 RC3 /SCK/SCL RC3 SCK SCL 14 RC4 /SDI/SDA RC4 SDI SDA 15 RC5 /SDO RC5 SDO 16 RC6 /TX/CK RC6 TX CK 17 RC7 /RX/DT RC7 RX DT 18 TTL/ST(2) I/O I Digital I/O In-circuit debugger and ... In-Circuit Debugger MUX ALU PORTC RC0 /T1OSO/T1CKI RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK RC7 /RX/DT W reg Low-Voltage Programming MCLR VDD, VSS Timer0 Timer1 Timer2 ... RD5/PSP5 RD4/PSP4 RC7 /RX/DT RC1 /T1OSI/CCP2 RC2 /CCP1 RC3 /SCK/SCL RD0/PSP0 RD1/PSP1 RD2/PSP2 RD3/PSP3 RC4 /SDI/SDA RC5 /SDO RC6 /TX/CK NC RC6 /TX/CK RC5 /SDO RC4 /SDI/SDA RD3/PSP3 RD2/PSP2 RD1/PSP1 RD0/PSP0...
- 234
- 999
- 0
Báo cáo hóa học: "Research Article Existence and Multiple Solutions for Nonlinear Second-Order Discrete Problems with Minimum and Maximum" ppt
... Then From λ0 C 2.78 0, then β0 b − a Furthermore, β0 0, which contradicts with β0 < 1, then λ0 C Furthermore, C 0, which contradicts with C > 0, , then − λ0 β0 b − a < 0, λ0 C > 0, a contradiction ... Mathematics Letters, vol 19, no 11, pp 1244–1248, 2006 12 C Gao, “Existence of solutions to p-Laplacian difference equations under barrier strips conditions,” Electronic Journal of Differential ... solutions for some discrete Sturm-Liouville problems,” Computers & Mathematics with Applications, vol 54, no 4, pp 535–543, 2007 10 R Ma, H Luo, and C Gao, “On nonresonance problems of second-order difference...
- 16
- 233
- 0
Minimum and maximum available prices and the outcome of competition a meta analysis of oligopoly experiments
... paper, HEC Montréal Schelling, T.,1960: The Strategy of Conflict, Cambridge, MA: Harvard University Press Scherer, F.M., and D Ross, 1990: Industrial Market Structure and Economic Performance, 3rded., ... demonstrate the influence of price controls on the average price by controlling for and max prices and other parameters, as well as Nash equilibrium price A large number of experiments assure there ... and separately The approach is to see whether the range of prices available to subjects affects their choice of prices According to standard Nash equilibrium theory, the range of prices (above...
- 48
- 421
- 0
THE RAW FOOD DETOX DIET THE FIVE-STEP PLAN TO VIBRANT HEALTH AND MAXIMUM WEIGHT LOSS docx
... Focus on enjoying your meals and improving your food choices 19 Dagoba and Green & Black’s 70-percent chocolate bars make the perfect dessert for any food category (These products are 70-percent ... healthier, more vibrant life Dr Steven Pearlman is director of the Division of Facial Plastic Surgery at St Luke’s-Roosevelt Hospital, president of the American Academy of Facial Plastic and Reconstructive ... directly for bulk shipments (which are typically much cheaper at wholesale) Look for farming cooperatives, which offer a vast assortment of fresh fruits and vegetables at great prices Shop from...
- 287
- 404
- 2
Báo cáo khoa học: "Comparison of Alignment Templates and Maximum Entropy Models for Natural Language Understanding" docx
... approach is summarized in Figure For our approach, we determine the corresponding formal target language concept for each word of a natural language input Therefore, we distinguish whether a word ... dependence on the two predecessor concepts: /-1 ri+2 ej • —2 = (5(ei d, e ' ) • (e — d c {I, Prior features: The single concept priors are incorporated by prior features They just fire for the currently ... the Kroneckerfunction Word features: Word characteristics are covered by the word features, which test for: - Capitalization: These features will fire if f3 is capitalized, has an internal capital...
- 8
- 367
- 0
Báo cáo lâm nghiệp: "The effects of thinning treatments on density, MOE, MOR and maximum crushing strength of Pinus brutia Ten. wood" ppt
... managed forests, juvenile wood what does it mean to forest management and forest products? Proceedings of a cooperative technical workshop, Forest Products Research Society/Society of American Foresters, ... Forest Products Research Society/Society of American Foresters, Published by the For Prod Res Society, USA, 1986 [39] Morling T., Effects of nitrogen fertilization and thinning on growth and clear ... larger crown thus causes higher wind stress and a further increased compensatory lower stem growth [39] These are the most probable reasons for the increased annual ring increment in the lower...
- 9
- 458
- 0
BIOMEDICAL LITERATURE MINING WITH TRANSITIVE CLOSURE AND MAXIMUM NETWORK FLOW
... unique numeric identifier The thesaurus 13 is useful for normalizing the terms versus the frequency of their occurrence and for replacing an uncontrolled vocabulary set with a controlled set (Rothblatt ... (parathyroid hormone), PTHR1 (parathyroid hormone/parathyroid hormonerelated peptide reactor 1), ECM (extracellular matrix), receptor for advanced glycation end products, HMGB1 (high mobility group ... Narayanasamy et al in 2004 for finding transitive associations among various biological objects using text-mining from PubMed research articles Transminer is based on the principles of cooccurrence...
- 64
- 136
- 0
Facts of Vietnam Freight forwarding industry and the role of Vietnam Freight Forwarders Association (VIFFAS) to the industry in international economic integration processhelpful to Oristar.doc
... forwarder is the commercial invoice, shipper's export declaration, and other documents required by the carrier or country of export, import, or transshipment As an analogy, freight forwarders have ... favorable conditions would be created for Vietnam freight forwarders According to Vietnam Freight Forwarders Association (VIFFAS), there are four reasons to freight-forwarding/logistic services ... with cargoes that are retained by sea carriers • Decree No 10/2001/ND-CP of March 19, 2001 regarding business conditions for maritime service provision the Government • Decree No 125/2003/NDCP of...
- 31
- 1,229
- 21
Application pillar dam and movable caisson dam technology in building barrier construction to prevent sea water rising and improving flood relief at estuary rivers.
... parts of river The third is applied for construction CofferDam Diversion canal of a part of sluice in cofferdam: Embankment of cofferdam for enclosing a part of river, Construction of a part of ... of sluice in cofferdam, Diversion through a part of remain river of original river After Upstream Downstream Barrier completing sluice construction, cofferdam Figure 3: Construction of traditional ... sluice on river must be broken out, Diversion through bed constructed part of sluice, Embankment of cofferdam for construction of the remainder part of sluice This method is used for construction...
- 10
- 730
- 3
Person to person : Communicative speaking and listening skills.Starter book - Third Edition/Jack C. Richards
... uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn ... tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt uploaded for tailieu.vn by tamtmt ...
- 129
- 4,517
- 0
Tài liệu Updating Administration and Support Skills from Microsoft Exchange Server 5.x to Microsoft Exchange 2000 Beta 3 docx
... trademarks, copyrights, or other intellectual property © 2000 Microsoft Corporation All rights reserved Microsoft, MS-DOS, MS, Windows, Windows NT, Active Directory directory service, ActiveX, BackOffice, ... may be reproduced or transmitted in any form or by any means, electronic or mechanical, for any purpose, without the express written permission of Microsoft Corporation If, however, your only ... begin the course by reviewing the interaction of Exchange 2000 with Active Directory™ directory service in Microsoft® Windows® 2000 Students then learn the component architecture of Exchange 2000...
- 14
- 439
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... full range of the intensity scale («-2» vs «-1»; «1» vs «2») is reserved for the cases where two or more targets are, directly or indirectly, compared at sentence or comment levels (e.g Both performed ... Proc of the Conference on Empirical Methods in Natural Language Processing, USA Riloff, Ellen, and Janice Wiebe 2003 “Learning extraction patterns for subjective expressions” In Proc of the Conference ... for automatically constructing a domain-specific corpus, to be used in the automatic classification of movie reviews The authors selected a collection of movie reviews where user ratings were...
- 5
- 499
- 0
Tài liệu Báo cáo khoa học: "Identifying Agreement and Disagreement in Conversational Speech: Use of Bayesian Networks to Model Pragmatic Dependencies" docx
... speaker or the current spurt for which we need to identify a corresponding A part The feature sets are listed in Table Structural features encode some helpful information regarding ordering and ... feature set, the accuracy reaches 91.34%, which is only slightly better than our 90.20% accuracy, which indicates that lexical, durational, and structural features capture most of the informativeness ... informativeness provided by DAs This improved accuracy with DA information should of course not be considered as the actual accuracy of our system, since DA information is difficult to acquire automatically...
- 8
- 497
- 0
Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf
... benefit from better packing Hydrophobicity and surface characteristics Because protein cores are typically hydrophobic, increased packing efficiency is often correlated with increased hydrophobicity ... Tighter packing can be achieved through the formation of hydrophobic clusters and enhanced van der Waals interactions Increased hydrophobicity is usually involved in decreased accessible surface areas ... PROCHECK: a program to check stereochemical quality of protein structures J Appl Cryst 26, 283–291 28 Russel, R. B & Barton, G.J (1992) Multiple protein sequence alignment from tertiary structure...
- 14
- 520
- 0
The Fast Food Diet Lose Weight and Feel Great Even If You’re Too Busy to Eat Right ppt
... for food Why Soft Drinks Are So Fattening Carbonated soft drinks are the single biggest source of calories in the North American diet, accounting for about percent of our daily calories According ... the Center for Science in the Public Interest, teenagers get 13 percent of their calories from soft drinks The average American drinks upward of 50 gallons of soft drinks annually! Apart from ... carbohydrates and protein Many commercial foods also contain added sweeteners in the form of high-fructose corn syrup, a highly concentrated source of calories We also eat loads of refined, calorie-dense...
- 258
- 2,751
- 0
RAN D OM WALK IN RANDOM AND NO N- RAND OM ENVIRONMENTS h E C D N D E D I T I O N pdf
... Library Copyright 2005 by World Scientific Publishing Co Pte Ltd All rights reserved This book, or parts thereof; may not be reproduced in any form or by any means, electronic or mechanical, including ... once Having one return, the probability of a second return is again In turn it implies that the particle returns to infinitely often with probability Proof of the Recurrence Theorem Introduce ... mostly strong theorems - which describe the properties of a simple symmetric random walk The proofs are not always presented In some cases more proofs are given, in some cases none The proofs are omitted...
- 397
- 367
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25