... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/ or gas diffusion layer [2] Water management is related with air supply tothe cathode and is one of the crucial ... is obtained by solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum ... membrane, GDL and bipolar plates will all experience expansion and contraction Because of the different thermal expansion and swelling coefficients between these materials, hygrothermal stresses are...
... the relation between the warm atmosphere andthe storms in the tropical monsoon Asia Survey and forecast the effects of the dams and irrigation systems in upstream tothe low parts of the basin ... such as pumping stations, irrigation and drainage canal systems, crop protection dikes and dams have been built in the Mekong Delta Almost these water works were investigated by the national budget ... alluvium tothe fields of the Delta Flooding water eliminates a great part of the salinity in the soil in the coastal areas and flushes toxicity released from acid sulfate soil Also, floods kill the...
... non-financial performance measures such as customer and employee satisfaction, customer and employee retention and quality measures and financial indicators such as profitability (Banker and Mashruwala, ... companies have a great amount of data which can be transformed into useful information by easing strategic management and control process Managing this information in a systematic and dynamic way ... etc.) structural capital (processes, information systems, databases, etc) and relationship capital (customer relationships, brands, trademarks, etc.) as the secondary issues to manage The most quoted...
... information and communication, external relations, education and training, working teams and committees andthe assembly system for decisions All of these are based on participation in theprocess ... that characterizes theprocess of technological innovation andthe creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge andProcess Management CASE STUDY ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was...
... and health incorporation onthe patterns observed among the total population—in social institutions such as the educational and health care systems, andon markers of health and social inequality ... Pakistan and Bangladesh have lower education and occupational qualifications than whites, on average, those from India, Africa and China have higher average qualifications (Modood 2003) Although ... (Landale, Oropesa and Bradatan 2006) and ethnic enclaves (Wilson and Portes 1980) suggests that some of the immigrant advantage may be due to these parents’ greater access to instrumental and...
... 24 What the rating agencies to earn their keep? The traditional answer to this question is that the agencies gather and analyze all sorts of pertinent financial and other information, andthe ... His data appear to indicate that as early as 1850 the U.S corporate bond market was as large or larger than that of countries such as Great Britain and France, and that by the eve of World War ... business, a natural outgrowth of the financial and operating information it compiled and sold The company merged with Standard Statistics, another information and ratings company, in 1941, to form Standard...
... the presence of mutual chemical interactions between enzyme intermediates and provides and explanation for catalase activity Other questions, such as the localization of the amino acid radical ... et al [50,58], we would not exclude that the radical plays a role in the autocatalytic binding of heme tothe apoprotein, a post-translational modification that is typical of mammalian peroxidases ... by a two-electron reaction or to Cpd II by a one-eletron processThe former reaction implies catalase activity The latter reaction is about two orders of magnitude slower than the former and...
... Sister onthe Western by Anonymous 47 choose them to send to Mother and My Young Lady andthe Missis andthe Children, and have one for themselves The Indians each had one, and salaamed and said, ... own ship and another We have a lot of R.E and R.F .A and A. S.C., anda great many horses and pontoons and ambulance waggons: the horses were very difficult to embark, poor dears It was an exciting ... inoculated against tetanus to- day They have it in the French Hospitals too Went tothe Voluntary Evening Service for the troops at the theatre at The Padres anda Union Jack andthe Allies' Flags;...
... in se and mala prohibita The prohibition against intoxication in public was classified as mala in se, inspired by the biblical story of Noah,52 and also as mala prohibita.53 The main reason behind ... conditional clauses4: valid and invalid A valid conditional clause refers toa real occurrence; an invalid conditional clause relates toa hypothetical situation that has not, will never, or can never ... scholars identify the criminal law with the sanction,6 but the criminal sanction does not stand alone and must necessarily follow from a valid conditional clause The criminal sanction is a measure...
... thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature andthe fact that the main processandthe modifier ... conceptual information and speech act information Penman has a rich variety of inquiries dealing with such information and so makes available a large set of resources and capabilities for any system ... semantic organisation that the grammar's semantics requires These categories, andthe relationships among them, constitute the upper model The upper model serves to organize the propositional content...
... NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA ... GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin ... Universitat Darmstadt, Germany) was applied at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma,...
... molecule) was detectable Recent Mossbauer studies con¨ firmed that both the FeFe cofactor andthe P-cluster are diamagnetic in the dithionite-reduced state and that the cofactor contains four FeII- and ... artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped peak at higher magnetic fields appears to be, at first glance, indicative of an axial signal However, a closer ... in the case of the Fe-only nitrogenase might be explained by the involvement of the additional iron atom (which replaces the heterometal atom) in that redox process As regards the lineshape and...
... 2.6 Theories on globalization and emerging markets Globalization, multinational companies, their structures andthe internationalization stages of a firm are all widely researched topics in management ... arvoketjussa sekä globaalilla tasolla alhainen konsolidaatioaste, jotka johtavat kysynnän ja tarjonnan epätasapainoon ja heikkoon kannattavuuteen Teollisuuden strategiset toimenpiteet muutosprosessiin ... johda pysyvään kannattavuuden paranemiseen Yritysten on joko luotava kokonaan uusia tuotteita tai uudistettava radikaalisti liiketoimintamallejaan leikatakseen kustannuksia, jotta tuotteiden ja...
... know a newspaper if the paperboy hit them in the face Reality: More than a quarter of U.S teens say they read a daily newspaper and more than a third say they read on Sunday As some newspapers ... dramatically that they run counter to broader cultural trends, are unknowable and unmeasurable, constantly evading our understanding and engagement The fact is, teens are unique, but they are ... markets we measure, while Sports and Information (news) are almost universally absent among the top three rated genres Drama, in the form of general drama, soap operas and Telenovelas, tends to...
... monoclonal diseases, the cell starts to synthesize Ig following the variable domain rearrangement Onthe coding DNA strand, the gene segments for the formation of the variable andthe constant ... total Ig nephelometric assays At gross concentrations these assay are suitable tools to monitor patients; however, as they are unable to distinguish between the monoclonal and polyclonal Igs they ... infections In some cases, the monoclonal Ig can have other effects, such as the ability to agglutinate red cells (cold agglutinin disease), to act as auto-antibody (autoimmune haemolytic anaemia), to...
... response tothe changes, and about theprocess for municipal decisionmaking; discover what provincial and local actions are taking place in response tothe changes; have a chance to say what ... Start-Up and Maintenance Benefit Cont’d: Poor families will be forced to vacate their housing, leaving rent owing to their landlord, with no way to pay it back Families on Ontario Works and ... Access to recreation and other children’s services is vital to healthy families and necessary to combat growing rates of childhood obesity, diabetes and mental health problems Children and Families:...
... extracellular surroundings and thus could be available for ligand association Among the inhibitory 20-peptides, aIIb 313–332 and aIIb 265–284 were the most effective antagonists of platelet aggregation ... conformational state and function during ADP-induced platelet activation It is also noteworthy that both aIIb 313–332 and aIIb 265– 284 sequences are adjacent tothe region that has been proposed to ... T., Storer, B.L., Ali, F & Samanen, J (1989) Demonstration of Ac–Arg–Gly–Asp–Ser–NH2 as an antiaggregatory agent in the dog by intracoronary administration Thromb Haemost 61, 183–188 Samanen,...