appliance general purpose receptacle loads excluding plug in type a c and heating equipment
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... preparations Evaluation of the two vaccine candidates revealed that they are reasonable candidates for further study in clinical trials Both candidates replicated well in Vero cells, a characteristic ... or the LY94 2A mutation to develop two live intranasal HPIV1 vaccine candidates Each of these vaccine candidates contained at least one genetically stabilized ts and non-ts att mutation These ... immunogenicity and efficacy was not unexpected since each vaccine was highly restricted in replication and since there is a strong correlation between the level of replication of vaccine virus and...
- 13
- 504
- 0
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx
... preparations Evaluation of the two vaccine candidates revealed that they are reasonable candidates for further study in clinical trials Both candidates replicated well in Vero cells, a characteristic ... or the LY94 2A mutation to develop two live intranasal HPIV1 vaccine candidates Each of these vaccine candidates contained at least one genetically stabilized ts and non-ts att mutation These ... immunogenicity and efficacy was not unexpected since each vaccine was highly restricted in replication and since there is a strong correlation between the level of replication of vaccine virus and...
- 13
- 520
- 0
Báo cáo y học: "Ipsilateral common iliac artery plus femoral artery clamping for inducing sciatic nerve ischemia/reperfusion injury in rats: a reliable and simple method" doc
... in drafting the manuscript and statistical analysis GF participating in statistical analysis and study design MRR: Preparing the revised paper and drafting the manuscript SMR participating in setting ... food and water All experiments were performed in accordance with institutional guidelines for animal care and use and also "Principles of laboratory animal care" were followed The animals weighing ... in setting up the method ABF participating in setting up the method FAA carried out pathologic assessment ARD participated in the design and cordination of the study All authors read and approved...
- 4
- 264
- 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG ... ACGTTGGATGGGAACATCACAGGAAATGAC fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC ... rev ACGTTGGATGTATGGTTCGACTGAGTCCAC ACTCGAGGCCTGTGAATTCC 93.73 GCCGGCTCCCAAGCTCC 92.03 CCTGCTGGCCATGCTCCTCAGC 92.99 GCTGCCTCTGCTCCCAGG 91.88 ACAAATCACCTCTGTCACCC 92.58 ACTCCATACCACTGGTCAGCTG 93.81...
- 12
- 355
- 0
Network Programming in .NET With C# and Visual Basic .NET phần 1 potx
... programming languages, C# and VB.NET, are used Both languages differ syntactically, but are equally capable and offer identical performance characteristics Languages in the NET framework are highly ... multiple inheritance, so the car class cannot inherit from a vehicle class and a Windows form Interestingly, every class within NET derives from a root called System.Object An interface is a contract ... than procedurally based This provides a natural mechanism to encapsulate interrelated data and methods to modify this data within the same logical construct An object is a programmatic construct...
- 57
- 931
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 2 pot
... AsyncCallback acceptCallBack; private AsyncCallback receiveCallBack; public Socket listenerSocket; public Socket clientSocket; public byte[] recv; VB.NET Private acceptCallBack As AsyncCallback ... byte[1]; clientSocket.BeginReceive(recv,0,1, SocketFlags.None,receiveCallBack,null); } VB.NET Public Sub acceptHandler(ByVal asyncResult As IAsyncResult) receiveCallBack = New AsyncCallback(receiveHandler) ... AsyncCallback object is passed to it because this object contains the reference to the callback function: receiveHandler Now, add the callback function to handle incoming data: C# public void receiveHandler(IAsyncResult...
- 56
- 469
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 3 doc
... returning data and read it in as it becomes available To this, we can create a stream by calling the GetResponseStream method Once the stream is obtained, we can read bytes from it in chunks Chapter ... cheap, informal, fast, and can be picked up at the receiver’s convenience Emails can be automatically generated and sent, making them ideal for automated status notification One day, you may receive ... It takes a socket and a terminator string as parameters Again, it reads in from the network stream one byte at a time and builds up the streamData string If the terminator string appears in the...
- 56
- 712
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 4 pdf
... AddressLists collection in the MAPI namespace (NS in the example above) Each element in the collection contains an AddressEntries collection Each entry in the latter collection contains a Name and Address ... same way, FTP uses a basic authentication mechanism: It accepts a username and password in plain text, which can be seen by anyone using a protocol analyzer at any point between the client and ... utility command-line interface The FTP protocol facilitates more than uploading and downloading: It must also be able to accommodate all manner of file-manipulation tasks This includes deleting, renaming,...
- 56
- 1,202
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 5 doc
... away from the system folders and anything else that may contain user data Each application is allocated its own folder and space such that untrusted applications cannot read each other’s data ... power and storage available across a multitude of nodes can greatly exceed what is practical to combine into one central server computer Famous P2P software includes Napster and Kazaa 7.5 Conclusion ... appears in the status bar Clicking this icon will authenticate the server as belonging to a particular company, in a speci c location This is achieved by using server certificates 9.6 Certificates...
- 56
- 678
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 6 docx
... data moving quickly 11.2.1 Caching Caching can increase network performance by storing frequently accessed static data in a location that provides faster data return than the normal access time ... instead was redirected to a caching server that had to reprocess the data Data can be cached at any point between the client and server Serverside caches can protect against out-of-date data, but ... for each file Each entry has an associated CRC value, which is analogous to a hash value in proving integrity checks for files that could have been corrupted in transit Creating a ZIP file takes...
- 56
- 721
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 7 ppsx
... ManagementClass ProcessClass = new ManagementClass("Win32_Process"); ManagementBaseObject inParams = ProcessClass.GetMethodParameters("Create"); ProcessClass.Scope = Scope; inParams["CommandLine"] ... inParams As ManagementBaseObject = _ ProcessClass.GetMethodParameters("Create") ProcessClass.Scope = Scope inParams("CommandLine") = tbExecute.Text ProcessClass.InvokeMethod("Create", inParams, Nothing) ... contents and the exact time (with microsecond accuracy) the packet was received The packet contents are stored in a byte array named Data This byte array appears to NET as a generic object; thus,...
- 56
- 1,325
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 8 doc
... Select Case dwParam1 Case LINECALLSTATE_OFFERING msgEvent = "Incomming call" hCall = dwDevice Case LINECALLSTATE_ACCEPTED msgEvent = "Call accepted" Case LINECALLSTATE_DISCONNECTED msgEvent = "Call ... switch(dwParam1) { case LINECALLSTATE_OFFERING: msgEvent = "Incomming call"; hCall = dwDevice; break; case LINECALLSTATE_ACCEPTED: msgEvent = "Call accepted"; break; case LINECALLSTATE_DISCONNECTED: ... dwUUICallInfoSize; linedialparams MinDialParams; linedialparams MaxDialParams; linedialparams DefaultDialParams; int dwNumTerminals; int dwTerminalCapsSize; int dwTerminalCapsOffset; int dwTerminalTextEntrySize;...
- 56
- 505
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 9 pps
... supports transactions A transaction is an atomic unit of work that either succeeds or fails as a whole In a banking system, a transaction might involve debiting a checking account via one message queue ... configuring a Windows XP machine as an ISATAP router is to enable forwarding on all interfaces connected to the Internet and enable both forwarding and advertising on the automatic tunneling pseudointerface, ... interface index, over which packets that match the address prefix may be transferred Interface indexes can be viewed by typing netsh interface ipv6 show interface at the command prompt Gateway/Interface...
- 56
- 478
- 1
Network Programming in .NET With C# and Visual Basic .NET phần 10 potx
... = DateTime.UtcNow.Ticks; svc = new localhost.Service1(); svc.BegingetServerVariableNames(new AsyncCallback(ServiceCallback1),null); svc.BegingetServerVariable("REMOTE_ADDR",new AsyncCallback(ServiceCallback2),null); ... SOAP attachment as distinct from plain text offers a performance advantage because the data will not be encoded and bloated in size SOAP attachments use the direct Internet message encapsulation ... source code, which can be obtained by calling soapsuds with the –gc switch Once the C# code can be edited, the namespace can be changed to something else, thereby avoiding the namespace clash 17.9.6...
- 57
- 483
- 1
a cross-cultural study on american-vietnamses verbal expressions in offering a gift and responding to a gift offer = nghiên cứu giao thoa văn hóa việt - mỹ về cách sử dụng ngôn từ để tặng quà và nhận quà
... predicating (propositional acts), and a particular intention in making the utterance (illocutionary force); an act involved in the illocutionary act, including utterance acts and propositional acts; ... does communication breakdown may occur in cross-cultural communication? Why are many utterances grammatically correct but communicatively and culturally meaningless? This is mainly because participants ... making an utterance, including the following: a general act (illocutionary act) that a speaker performs, analyzable as including the uttering of words (utterance acts), making reference and predicating...
- 67
- 1,456
- 4
A cross – cultural study on american – vietnamese verbal expressions in offering a gift and responding to a gift offer
... misunderstandings Why does communication breakdown may occur in cross-cultural communication? Why are many utterances grammatically correct but communicatively and culturally meaningless? This is mainly ... Part B Development Chapter I Theoretical background I.1 Language and communication I.2 Language and culture I.3 Communicative competence I.4 Speech acts I.4.1 Definition I.4.2 Types of speech ... here confused the participants and make the communicative process unsuccessful From her personal observations in teaching career, the writer would like to have an insight into a really nice social...
- 7
- 1,214
- 21
Tìm hiểu về đồ 3D Plug-in API và ứng dụng
... sun and eye positions that we can bind(tao 1tham so cho cac vi tri mat troi va mat cua chng ta co the nhin dc) ) // to auto update a bunch of materials.(de tu dong thiet lap cac nguyen vat lieu) ... g.globalParams = g.pack.createObject('ParamObject'); g.sunPosParam = g.globalParams.createParam('sunPos', 'ParamFloat3'); g.sunPosParam.value = [1000, 200, 100]; g.eyePosParam = g.globalParams.createParam('eyePos', ... Set the material's drawList(thiet lap cac tai lieu cua drawlist) material.drawList = g.viewInfo.performanceDrawList; // This will create the effects's params on the material.(dieu tao cac hieu...
- 45
- 588
- 0
Electric and hydrogen consumption analysis in plug-in road vehicles
... Figure CO2 emission factor variation [%], Cascais-Lisboa driving cycle (34.2km): (a) average acceleration, (b) road grade, (c) cargo weight, (d) accessories electrical load, (e) initial SOC ISSN ... gives the assurance that the vehicles are on their maximum power capacities Table Driving cycle, Cascais to Lisbon, 34.2km (Cascais-Lisboa) Speed Acceleration Time Idle Max Average Max Average [s] ... Load [W] 5235 100 Initial SOC 75 [%] 50 25 Average Acceleration [m/s2] CO2 emissions factor Cycle and autonomy.[g/km] Vehicle A (a) Vehicle A (b) Vehicle A (c) Vehicle B Cycle Aut Cycle Aut Cycle...
- 22
- 473
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008