anastasi a and urbina 1997 psychological testing 7th ed prentice hall international uk ltd
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx
... flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all providers in every primary care clinic Evaluation plan The primary endpoints ... testing a performance monitor, to support installation of the HIV Testing Clinical Reminder, and to participate as full partners in enhancing station accountability After obtaining national and ... confirm and extend these data, we evaluated the rates of HIV testing in veterans seen in the five southern California and Nevada VA facilities (otherwise referred to as Veterans Integrated Service...
- 13
- 341
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx
... flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all providers in every primary care clinic Evaluation plan The primary endpoints ... testing a performance monitor, to support installation of the HIV Testing Clinical Reminder, and to participate as full partners in enhancing station accountability After obtaining national and ... confirm and extend these data, we evaluated the rates of HIV testing in veterans seen in the five southern California and Nevada VA facilities (otherwise referred to as Veterans Integrated Service...
- 13
- 588
- 0
shleifer and vishny - 1997 - a survey of corporate governance
... performance of German companies in their 1974 sample, and that both bank and nonbank block holders improve performance in a 1985 sample For Japan, Kaplan and Minton (1994) and Kang and Shivdasani (1995) ... common in practice A vast empirical literature on incentive contracts in general and management ownership in particular dates back at least to Berle and Means (1932), who argue that management ownership ... Corporate governance in Russia: An initial look, in Roman Frydman, Cheryl W Gray, and Andrzej Rapaczynski, Eds.: Corporate Governance in Central Europe and Russia: Vol Insiders and the State (Central...
- 47
- 908
- 0
600 sentences of certificate A and B
... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... weak c to d this > a 51 Sun weather can always be depended on in southern countries a Sun b always c on d in > a 52 The man that wife and family are away seems very lonely a that b and c are ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...
- 280
- 884
- 3
Test yourself A and Test 1(Kiều Tính)
... climbing, backpacking, and adventure tourism Some recreational activities are made illegal such as gambling and drug use Research has shown that recreation contributes to life satisfaction, quality ... life, health and wellness, and that the use of recreation as a diversion may have clinical applications to individuals with chronic pain and other health impairments In some cultures and religions, ... heavy fog have cancelled B All flights because of the heavy fog have been cancelled C All flights have cancelled because of the heavy fog D All flights have been cancelled because of the heavy fog...
- 5
- 719
- 1
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL-1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...
- 11
- 653
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs ... LlCBP3 3A) ; and a family 20 N-acetylhexosaminidase (LnbA) The chiA and yucG genes are separated by 19 bp in an operon starting with a putative transcriptional regulator positioned 166 bp upstream ... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)14 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard...
- 14
- 683
- 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf
... b1,3galactosidases, giving rise to a disaccharide and a monosaccharide, and was thus identi ed as a mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... glycosylation pattern associated to malignancy We found in fact that NeuAca2-3Galb1-3[Fuca1-4]GlcNAcb1-3Gal and NeuAca2-3Galb1-3GlcNAcb1-3Gal are the main oligosaccharides released by endo-b-galactosidase ... part) and T5AS clone (h in lower part, and A, B, and C of upper part) metabolically radiolabelled with [3H]Gal were characterized Upper part: cell lysates were treated with N-glycanase and passed...
- 9
- 460
- 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; ... primers used in this study were as follows: ERRa: 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ ... enzymatic and respiratory parameters, we showed that the expression of ERRa and PRC was related to the respiratory capacity and phosphorylating respiration Inhibition of ERRa and PRC in the oxidative...
- 13
- 503
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FnBPA Finally, we selected and characterized a mAb produced against the recombinant repetitive region of FnBPB that recognizes an epitope shared by repeats of FnBPA and FnBPB, and inhibits staphylococcal ... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... Injection began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and...
- 16
- 560
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT ... kPa For the a- domain, an average molecular mass of 3021.3 Da (3021.7 Da, theoretical) was observed, calculated from the detected [M + 5H]5+ and [M + 4H]4+ quasi molecular ions at m ⁄ z 605.2 and...
- 14
- 485
- 0
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx
... PTH-containing and PIN-containing crude fractions were dialyzed against deionized water and freeze-dried, and a1 -PTH, a2 -PTH and b-PTH were separated (at room temperature) by semipreparative RP-HPLC ... membrane depolarization, and in (B) and (C) increasing extracellular Ca2+ concentration (from to 10 mM) markedly reduces a1 -PTH-induced muscle depolarization, whereas decreasing extracellular Ca2+ ... Molecular masses of puri ed PIN -a and a1 -PTH A typical electrospray mass spectrum of puri ed wheat PIN -a (Fig 1A) reveals that its apparent heterogeneity is related to complex post-translational...
- 13
- 436
- 0
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... settings and annotations are saved and available the next time the user logs on Finally on the Data Download page, users may download data so that they can use the patterns and derivations offline ... error-driven learners will be trapped if Gcurr generates a language that is a superset of the language generated by Gtarg There is a wealth of learnability literature that addresses local maxima and their ... CHILDES database in five languages (English, German, Italian, Japanese and Russian), we found that approximately 85% are degree-0 and an approximate 10 out of 11 have no internal DP structure Adopting...
- 8
- 368
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... rebinding are shown in Figs and The transient absorption decays were analyzed using a standard least-squares technique using homemade software for PC After kinetic normalization, analysis showed that ... derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found to exceed 2.2 ... Lepeshkevich and B M Dzhagarov Fig Total oxygen affinity (K t) of liganded hemoglobin as a function of NaCl concentration Bars 1, and are the relative changes in Kt at pH 6.8, 7.4 and 8.5, respectively As...
- 11
- 577
- 0
Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt
... PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢ The DNA products ... coloured in orange, cyan and magenta, as in Fig In (E) and (F) the corresponding amino acids for different surface charges on SUMO-2 and SUMO-1 are shown Positively charged, negative charged and ... neutral polar residues are coloured blue, red and magenta, respectively, and nonpolar residues are shown in green The views in (C–F) are similar to that of Fig 3A and those of (A) and (B) are rotated...
- 9
- 441
- 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf
... cPLA2 -a and convert arachidonic acid into prostaglandin H2 [8,9] To date, two distinct COX isoforms, COX-1 and COX-2, have been identi ed and characterized, and an alternative splice variant ... goat polyclonal anti-cPLA2 -a and rabbit polyclonal anti-calreticulin sera, followed by donkey FITC-conjugated anti-sheep and donkey Texas Red-conjugated anti-rabbit sera Cells were visualized ... extracellular calcium Cells were then fixed and permeabilized and incubated with goat polyclonal anti-cPLA2 -a serum and mouse monoclonal antibodies against annexin V, annexin I, p11, caveolin, actin...
- 13
- 387
- 0
The a and b adapters are used as priming sites for both amplification
... the wells not allow more than one ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to ... • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase...
- 19
- 390
- 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx
... (EDE) content of flax leaves Galactolipids were separated and puri ed as described in Materials and methods EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm Average ... separated and puri ed as described in Materials and methods UV chromatograms (267 nm) of galactolipids extracted from: (A) unstressed plants, (B) infected plants (at h after inoculation with E carotovora ... described in Materials and methods Average values and standard deviations of five independent experiments are presented EDE, esteri ed divinyl ethers fatty acids and then esteri ed to galactolipids...
- 10
- 387
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25