analysing hypersensitivity to chemotherapy in a cellular automata model of the immune system
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
... intend to explore these parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the ... We also extend these models to a new task domain that can elaborate on referential patterns in the presence of various forms of shared visual information Finally, we make use of a corpus gathered ... may benefit from a datadriven model of how collaborative pairs adapt their language in the presence (or absence) of shared visual information A successful computational model of referring behavior...
- 8
- 567
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... damaging tissue and releasing pro -in ammatory agents Activated eosinophils, neutrophils, macrophages and lymphocytes increase in number at sites of in ammation and each are capable of modifying ... cell lysates (data not shown) are capable of binding to the cytoplasmic domain of the siglec-10 protein The binding of SHP-1, however, was missing from the Y667F mutant indicating this to be the ... Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion...
- 14
- 540
- 0
DETERMINANTS OF CREDIT TO HOUSEHOLDS IN A LIFE-CYCLE MODEL pdf
... expectation operator conditional on information available at the beginning of period The life of individuals consists of two parts.1 During initial J1 years they participate in the labor market ... default (known a priori with certainty at the aggregate level), and all of them insure fully against that risk by paying the appropriate premium to the bank, the spread will also contain the ... decrease of the deposit rate deter individuals from savings The aggregate value of deposits, and hence capital, is falling, which leads to an increase of the market rate As regards the lending rate,...
- 43
- 1,098
- 0
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt
... of data packets each capable of transmitting to 1023 bytes of data Data0 Data1 Data packets have the following format Sync PID Data CRC16 EOP Handshake Packets There are three type of handshake ... containing the control data to be sent, a stall packet indicating the endpoint has had a error or a NAK packet indicating to the host that the endpoint is working, but temporary has no data to ... packet types Token packets indicate the type of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame...
- 30
- 745
- 0
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx
... C-NodeA> case-mark(C-Nodea) or, ii) C-NodeA - head(Chain) * ease-mark(C-Nodea) In an argument Chain, , theta-mark(C-Node0) In describing the representation of a Chain, we have drawn ... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... chains for lexical antecedents, and attempts to append traces to existing chains This operation must in turn satisfy the chain_view relation, to ensure the added link obeys the relevant grammatical...
- 6
- 364
- 0
Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx
... people living in an area stretching from the Arctic Ocean in the north and the Mediterranean Sea in the south and from the Atlantic Ocean in the west to the Pacific Ocean in the east The European programme ... the advantages of a social model of health The past Protecting children’s health in a changing environment few years have seen an increased commitment to direct tackling of the social determinants ... Regional Priority Goal Ensuring public health by improving access to safe water and sanitation i will take advantage of the approach and provisions of the Protocol on Water and Health3 as a We rationale...
- 92
- 501
- 0
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... protein standards, internal controls and blanks were always assayed at the same time and in the same way All samples were always determined in triplicate and in a blind fashion Immunoblot analysis ... each mouse eats 4–5 mg chow/day, the estimated average vitamin E intake for each animal was ~8–10 I.U./day Assuming that each mouse drinks to mL water/day, the estimated daily intake of GFAP/Actin ... occurs Inflammatory mechanisms are also operative in the AD brain and significantly contribute to the pathophysiology of the disease Although classical defined inflammation, including such features...
- 9
- 490
- 0
Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf
... apoptosis as well as the ability of intra-articular TRAIL gene transfer to induce synovial apoptosis suggest that intra-articular injection of rTRAIL also might be able to induce apoptosis of hyperplastic ... synovium In this report, we have examined the ability of rTRAIL to induce synovial apoptosis in vivo in inflamed rabbit knee joints following intra-articular injection Similar to the effects of intra-articular ... intra-articular injection of Ad-TRAIL, injection of exogenous rTRAIL was able to induce synovial apoptosis in arthritic joints of rabbits as well as reduce inflammation In addition, there was no adverse...
- 8
- 418
- 0
Báo cáo y học: "roteoglycan 4 downregulation in a sheep meniscectomy model of early osteoarthritis" docx
... decrease in PRG4 in early OA could have a role in the pathogenesis of cartilage degeneration In the present study we have demonstrated in an animal model that early degeneration of cartilage was associated ... indentation testing, which requires repeated saline lavage and swabbing of the cartilage surface After ovine lateral meniscectomy, there was a decrease in PRG4 immunostaining with a marked loss of PRG4-positive ... pathways are present in OA, and the inflammatory cytokine IL-1 seems to be one of the most influential factors, demonstrating deleterious effects for cartilage in vitro and in vivo, acting to inhibit...
- 6
- 424
- 0
Báo cáo y học: "Human, viral or mutant human IL-10 expressed after local adenovirus-mediated gene transfer are equally effective in ameliorating disease pathology in a rabbit knee model of antigen-induced arthritis" ppt
... principal function of IL-10 appears to be anti-inflammatory, limiting and eventually terminating inflammatory responses by inhibiting synthesis of monocyte and macrophage derived pro-inflammatory ... measure of inflammation To test and compare the ability of hIL-10, vIL-10, and mut.hIL-10 to inhibit inflammation in the inflamed rabbit knees, the number of leukocytes in the lavage fluids at ... end of this incubation, the media was recovered and stored at -20°C Unincorporated 35SO42- from media was chromatographically separated using PD-10 columns (Phar- macia, Piscataway, NJ, USA), and...
- 7
- 316
- 0
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... TGGCTGTTTCTGGCTGTTACTG and AATCAGCAGCGACTCCTTTTCC; IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis ... Shizuoka Laboratory Animal Center (Shizuoka, Japan) All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine Animal experiments were done in accordance with the guidelines ... 164:6067-6074 Kuroiwa T, Kakishita E, Hamano T, Kataoka Y, Seto Y, Iwata N, Kaneda Y, Matsumoto K, Nakamura T, Ueki T, et al.: Hepatocyte growth factor ameliorates acute graft-versus-host disease and promotes...
- 9
- 463
- 0
Báo cáo y học: "Indigenous utilization of termite mounds and their sustainability in a rice growing village of the central plain of Laos" pdf
... Los Banos: International Rice Research Institute; 2006:369-389 Adachi Y, Ono E, Miyagawa S: Expansion of Lowland Paddy Field Areas in the Plain Region of Laos Geographical Review of Japan (Ser.B) ... Watanabe H, Abe K, Hoshikawa T, Prachaiyo B, Sahunalu P, Khemnark C: On trees in paddy fields in Northeast Thailand Southeast Asian Studies 1990, 28:45-54 Kosaka Y, Takeda S, Prixar S, Sithirajvongasa ... Miyagawa et al Journal of Ethnobiology and Ethnomedicine 2011, 7:24 http://www.ethnobiomed.com/content/7/1/24 Page of In the plain areas of Laos as well as in Northeast Thailand, which is adjacent...
- 6
- 522
- 0
báo cáo khoa học: "Therapeutic activity of two xanthones in a xenograft murine model of human chronic lymphocytic leukemia" doc
... interpreted the data and revised the manuscript; CBi interpreted the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... treated with either allanxanthone C or macluraxanthone according to the same protocol as before No lethality was observed in these two groups of animals, suggesting an absence of toxicity of the ... Guttiferaes are capable of in vivo antileukemic effects in a xenograft murine model of human CLL These therapeutic activities of the natural compounds, of similar extent, occur without apparent toxicity...
- 3
- 309
- 0
Báo cáo y học: "“Floating arm” injury in a child with fractures of the proximal and distal parts of the humerus: a case report" docx
... neurovascular examination was normal Plain radiographs showed a displaced fracture at the proximal metaphyseal-diaphyseal junction of the left humerus and ipsilateral displaced extension type supracondylar ... the combination of ipsilateral fracture of the elbow and forearm Gausepohl et al [7] reported a case with fracture dislocation of the elbow combined with unstable distal forearm fracture of the ... reduction of the supracondylar humerus fracture in a “floating arm” injury like in our case A temporary Kirschner wire allows the surgeon to stabilize the humeral shaft and control the motion in the...
- 4
- 409
- 0
Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt
... mice was analyzed for 69 chemokines and cytokines using Luminex-based beadarray L-4F treatment resulted in a trend toward decreased levels of tissue damage and inflammation indicators, including ... Bruin Pharma and Alan M Fogelman is an officer in Bruin Pharma The remaining authors have no competing interests Authors' contributions JW contributed to acquisition of data, performed data analysis ... such as IL-10, a Th2 cytokine involved in B cell activity upregulation and linked to increased IgG anti-dsDNA autoantibodies [55], CCL19, and VCAM-1, indicate increased autoimmune response and increased...
- 13
- 360
- 0
Báo cáo y học: "Heliox improves pulmonary mechanics in a pediatric porcine model of induced severe bronchospasm and independent lung mechanical ventilation" pdf
... Page 66 Critical Care 1999, Vol No and anti-inflammatory agents have become the standard of care for reactive airway disease and asthma However, some patients fail to respond to aggressive therapy ... pentobarbital were given to ensure adequate anesthesia (titrated to achieve a heart rate of < 160 beats/min, systolic blood pressure ≤ 140 mmHg, and absence of withdrawal to painful stimuli) Each ... between patients and their response to therapy makes the study of a single agent during acute, severe bronchospasm difficult to extrapolate to the clinical setting Studies have shown a variable response...
- 6
- 244
- 0
Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt
... extracts ‘Immunoeducation’: a novel strategy or an utopian goal? Bacteria or bacterial products are already being tested against allergic diseases Encouraging preliminary data are coming from animal ... allergic asthma in animal models [29] Adjuvant DNA immunostimulatory sequences can provide part of the immunostimulatory effects of Freund’s adjuvant without the severe inflammatory and toxic side ... in those ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and...
- 4
- 335
- 0
Influence of fluid resuscitation on renal microvascular PO2 in a normotensive rat model of endotoxemia potx
... Creatinine clearance (Clearcrea) was assessed as an index of the glomerular filtration rate according to the standard procedure to measure the function of the investigated kidney Available online ... withdrawal of blood and continuous infusion of Ringer's lactate at a rate of 15 ml/kg/hour (Baxter, Utrecht, The Netherlands) The body temperature of the rat was maintained at 37 ± 0.5°C during the ... Germany) A catheter in the right carotid artery was connected to a pressure transducer to monitor the arterial blood pressure and the heart rate The right jugular vein was cannulated and the catheter...
- 13
- 179
- 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx
... Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cells Suha Saleh1,2, Fiona Wightman1,2, Saumya Ramanayake1, Marina Alexander3, Nitasha Kumar1,2, ... the cytoplasm The absence of MS RNA in the cytoplasm could potentially be secondary to a block in nuclear export of viral mRNA or destruction of MS RNA in the cytoplasm We were unable to distinguish ... safety profiles of drugs such as IL-7 and vorinostat Strategies that activate latent HIV in infected individuals on cART are likely to include combinatorial approaches and our model provides a robust...
- 31
- 268
- 0
Characterization of lung dendritic cells in a novel murine model of asthma
... resulting in the release of various inflammatory mediators which in drive the early phases of allergic reactions In addition, activated mast cells and basophils also produce an array of cytokines and ... of the lung parenchyma has significant limitations Characteristic features airway remodelling of human asthma such as intraepithelial recruitment of eosinophils, lamina propria inflammation and ... transferred intratracheally (Hammad et al., 2010) It has been shown that pulmonary immune tolerance rather than airway inflammation can be induced by respiratory administration of a harmless antigen...
- 205
- 413
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008