alizarin red staining of the samples on a weekly basis the increasingly darker stains indicated greater calcium deposition over time the control samples did not exhibit positive stain for calcium
... increasinglydarkerstainsindicatedgreatercalciumdepositionovertimeThecontrolsamplesdidnotexhibitpositivestainforcalcium 71 Figure 3.12: Cell count ofsamples from the ... low a degradation rate impedes tissue formation and too high a degradation leads to inadequate material for ECM deposition 2.3.3 Selection of materials for scaffolds The materials used for scaffolds ... property of silk also makes it attractive as a biomaterial Degradation of biomaterials is important because by matching the rate of scaffold degradation to the rate of tissue growth, it facilitates the...
... generation", Internet Survey URL:http://www.ontariosea.org/Storage/27/1883 _Evaluation _of_ parameters_affecting_wind_turbine_power_generation.pdf [5] Balasubramaniam Babypriya, Rajapalan Anita, ... mechanical power with wind speed variation and other variables (air pressure, air density and temperature) The variation range of these variables is used to cover the atmosphere effect onthe mechanical ... generators, Hydro generators and Storage devices Each of these components was basically modeled on studies of mathematical models and has associated specific parameters The interfacing with MATLAB...
... (a gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) ... c-secretase assay (Eur J Biochem 270) 497 ofthe Ab-bands was quantitated and Ab-secretion was calculated relative to the protein concentration ofthe lysates prepared from the cells in each well, as ... a definite advantage over traditional Ab-antibody based assays, such as ELISA and immunoprecipitation, for measuring c-secretase activity by allowing a direct measure of c-secretase activity The...
... the relationship between calcium phosphate–CPP aggregation as nanoclusters and the capacity to bind and maintain calcium in a bioavailable form The present investigation addressed the question ... radius; absolute need for concomitant presence of Ca2+ and CPP for optimal aggregation) At the same time, they also demonstrated that the ability to aggregate, in terms of dimension and concentration ... precipitation ofcalcium phosphate Then, CaCl2 was added in order to obtain the desired final Ca2+ concentrations Characterization of CPP aggregation by laser light scattering The aggregative properties...
... top ofthe cell, allowing the visualization of larger plasma membrane areas and the identification of small membrane domains (Fig 5E–H) These data clearly confirmed that EGFr and GD3 are colocalized, ... anti-EGFr Ig recognizing the extracellular domain In addition, to ease the separation between GEM and other parts ofthe plasma membrane, the focal plane was mainly adjusted through the top of ... depletion of cholesterol (another membrane component that regulates GEM formation) can alter the membrane distribution of EGFr [36,37], qualitative and quantitative changes in ganglioside expression...
... temperature up to 400 K [7] and demonstrated electrical-controlled ferromagnetism Onthe other hand, for practical applications, it is desirable to controlthe distribution of Mn and to avoid the formation ... condition, and GaAs has a nearly identical lattice constant as Ge, this phenomenon may be caused by other factors, such as different thermal coefficients for Ge and GaAs [19] The effect of Ge/GeMn ... wrote the manuscript All authors read and approved the final manuscript Acknowledgments The Australia Research Council, the Focus Center Research Program - Center on Functional Engineered Nano Architectonics...
... oak can take growth advantages before these species The failure of natural regeneration of oak can be then attributed particularly to browsing damage, insect (Tortrix viridana) damage, predation ... in the herb layer in the actual stand type In each ofthe stands, research polygon (RP) was established in such a way that it would represent the variability of stand conditions The actual natural ... conception of close-to-nature forest management The aim ofthe study was to determine the growth response of natural regeneration of oak (mast year in 2002) at different variants of regeneration...
... area were captured using a flat bed scanner and their area determined using Scion Imaging Software (Beta 4.0.1, Scion Corporation, Maryland, USA) Photosynthetic performance of Sitka spruce On ... performance of Sitka spruce 417 Figure Variation in maximum photosynthetic rate (Amax), stomatal conductance (Gs) and the ratio of internal to ambient CO2 concentration (Ci/Ca) for shoots from control ... 2.5 Diurnal gas exchange, chlorophyll fluorescence, shoot water potential and hydraulic conductance determinations Dark respiration rates, Amax and leaf water status at a saturating irradiance (200...
... of PAR under overcast and clear sky conditions For each analysis of variance, Tukey’s test was used to compare the means Analysis of variance was performed separately for each sky condition and ... global radiation This would explain thegreater attenuation of PAR wavelengths compared to global radiation as the horizon is approached Under clear sky conditions, the angular distribution of ... formula with b set to explained nearly half ofthe sky variation obtained at a wavelength of 575 µm Grant et al [21] reported that PAR radiance was 5.6 times higher at the zenith than at the horizon,...
... measure distance over time, there is a common axis with the measured wood properties The axis ofthe dendrometer data is therefore rotated in a way that the radial distances of both measures are ... from a daily to a distance basis As an approximation, it was assumed that the production of phloem was more or less constant throughout the year The daily dendrometer data were rescaled so that the ... property data was mapped onto a daily time step, using thetime and distance-based data arrays A critical step in the mapping process was the identification of growth ring boundaries The sufficiently...
... plantations make up more than 30% ofthe land area The plantations are highly productive, and therefore managed on short rotations (12–30 years) Intensive site preparation techniques are regularly ... other forest plantations [6, 15, 34] and may be a result ofthe increased supply of available carbon, and the higher temperature and moisture content, factors that favour a rapid increase in the ... microbial population Increased microbial biomass may also be favoured by mechanical disturbance ofthe soil by increasing the availability of carbon According to Salonius [35], disturbance of the...
... repeated measurement component (γ was excluded ) n Linear regression analysis of SLA as a function of nutrient concentration was undertaken to compare the slope ofthe relationship among ... differences obtained for crown width and leaf biomass and area forthe main stems indicate that competition reduced the aerial space occupancy of individual crowns and that the amount of foliage they supported ... ofthe contrasts was significant forthe secondary stems (table II) Relative growth rate for both RCD and height of main and secondary stems decreased significantly with age and the age x spacing...
... neutral ammonium-acetate method [26]; available Ca and K using N ammonium acetate as extracting solution [37]; and available P using to the Bray-Kurtz [6] procedure Some ofthe important soil characteristics ... concentrations and the lowest of Ca, demonstrating a nutrient imbalance [27] Theoretically, the Ca and Mg composition of leaf litter is increased compared to leaf contents because ofthe loss of organic ... ofthe fact that there is four times as much available soil P at FG than at EP (table II) The usual clear relationship between available soil P (in Ah horizon) and P resorption does not exist any...
... information still needs to be acquired onthe effect of competition at young ages for jack pine In particular, there is a lack of information onthe amplitude of competition in young stands that ... as a measure ofthe productive capacity ofa plant [12], has been suggested as an alternative to absolute measures that could provide an adequate evaluation ofthe competitive status of trees and ... rate of change in stem dimensions These absolute measures indicated that the growth of stems and crowns and the amount of foliage decreased as the intensity of competition increased As they are...
... importance ofthecontrolonthe axillary buds by the apical part ofthe shoot (Kramer and Kozlowski, 1979) Observations ofthe effects ofthe natural death ofthe apical bud during the winter, and ... stimulation of lateral branch development, the death ofthe apical bud may also cause a crooked stem form (Harmer, 1992b) In natural conditions, the death ofthe apical bud during the winter is not ... contrast, after years, branch formation was more important onthe GUs from the late flushes The increased branch formation onthe late flushes was a consequence of both a higher number of axillary...
... the observation that, during early development of roots, only cell elongation and cell division occur, and later on cell differentiation, lignification and hardening begin (Esau, 1960) Changes in ... initially and then increased gradually This decrease may be due to decreased water absorption by the cuttings until the functional roots were formed Grange and Loach (1983) opined that the decrease ... of y solute but exaggerated any rise of potential, due to the fall in ’P bark ofl:en associated with rises in osmotic potential ofthe expressed sap The relative conductivity decreased initially...
... comparison of transcription activities between stressed condition and non-stressed (control) plants onthe same oligoarray Hybridization solution was prepared with 825 ng each of Cy3- and Cy5-labelled ... Proline accumulation in roots of tolerant cultivars of rice starts earlier after the initiation ofthe stress treatment and was significantly more than their leaves [44] The expression patterns of ... and normalized according to the quantile method for standardization among array slides by EXPANDER version 5.0 [62] A gene was declared ‘expressed’ if the mean signal intensity ofthe gene was...
... and assisted in the statistical data analysis, IK developed the hardware, SG evaluated the statistical data analysis and its presentation, NG oversaw the project and the manuscript preparation ... contribution of KarmelSonix' Data Archival and Validation Team:Anat Shkolyar, Diana Goldstein, Yelena Vivat, Janna Tenenbaum-Katan, Shoval Dekel and Ben Alpert Figure Bland-Altman Joint Distribution ... forces onthe tracheal walls and pull them inwards to a partial collapse The cross section ofthe narrowed trachea further collapses and the flow velocity increases even more creating large shear forces...