0

alizarin red staining of the samples on a weekly basis the increasingly darker stains indicated greater calcium deposition over time the control samples did not exhibit positive stain for calcium

Effects of combined mechanical and pulsed electromagnetic field stimulations on the osteogenesis of bone marrow stem cells

Effects of combined mechanical and pulsed electromagnetic field stimulations on the osteogenesis of bone marrow stem cells

Y - Dược

... increasingly darker stains indicated greater calcium deposition over time The control samples did not exhibit positive stain for calcium 71 Figure 3.12: Cell count of samples from the ... low a degradation rate impedes tissue formation and too high a degradation leads to inadequate material for ECM deposition 2.3.3 Selection of materials for scaffolds The materials used for scaffolds ... property of silk also makes it attractive as a biomaterial Degradation of biomaterials is important because by matching the rate of scaffold degradation to the rate of tissue growth, it facilitates the...
  • 209
  • 1,817
  • 0
Performance analysis of wind turbine systems under different parameters effect

Performance analysis of wind turbine systems under different parameters effect

Vật lý

... generation", Internet Survey URL:http://www.ontariosea.org/Storage/27/1883 _Evaluation _of_ parameters_affecting_wind_turbine_power_generation.pdf [5] Balasubramaniam Babypriya, Rajapalan Anita, ... mechanical power with wind speed variation and other variables (air pressure, air density and temperature) The variation range of these variables is used to cover the atmosphere effect on the mechanical ... generators, Hydro generators and Storage devices Each of these components was basically modeled on studies of mathematical models and has associated specific parameters The interfacing with MATLAB...
  • 10
  • 545
  • 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Báo cáo khoa học

... (a gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) ... c-secretase assay (Eur J Biochem 270) 497 of the Ab-bands was quantitated and Ab-secretion was calculated relative to the protein concentration of the lysates prepared from the cells in each well, as ... a definite advantage over traditional Ab-antibody based assays, such as ELISA and immunoprecipitation, for measuring c-secretase activity by allowing a direct measure of c-secretase activity The...
  • 12
  • 471
  • 0
Báo cáo khoa học: Casein phosphopeptide promotion of calcium uptake in HT-29 cells ) relationship between biological activity and supramolecular structure ppt

Báo cáo khoa học: Casein phosphopeptide promotion of calcium uptake in HT-29 cells ) relationship between biological activity and supramolecular structure ppt

Báo cáo khoa học

... the relationship between calcium phosphate–CPP aggregation as nanoclusters and the capacity to bind and maintain calcium in a bioavailable form The present investigation addressed the question ... radius; absolute need for concomitant presence of Ca2+ and CPP for optimal aggregation) At the same time, they also demonstrated that the ability to aggregate, in terms of dimension and concentration ... precipitation of calcium phosphate Then, CaCl2 was added in order to obtain the desired final Ca2+ concentrations Characterization of CPP aggregation by laser light scattering The aggregative properties...
  • 13
  • 468
  • 0
Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc

Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc

Báo cáo khoa học

... top of the cell, allowing the visualization of larger plasma membrane areas and the identification of small membrane domains (Fig 5E–H) These data clearly confirmed that EGFr and GD3 are colocalized, ... anti-EGFr Ig recognizing the extracellular domain In addition, to ease the separation between GEM and other parts of the plasma membrane, the focal plane was mainly adjusted through the top of ... depletion of cholesterol (another membrane component that regulates GEM formation) can alter the membrane distribution of EGFr [36,37], qualitative and quantitative changes in ganglioside expression...
  • 10
  • 327
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Structural evolution of GeMn/Ge superlattices grown by molecular beam epitaxy under different growth " pot

Điện - Điện tử

... temperature up to 400 K [7] and demonstrated electrical-controlled ferromagnetism On the other hand, for practical applications, it is desirable to control the distribution of Mn and to avoid the formation ... condition, and GaAs has a nearly identical lattice constant as Ge, this phenomenon may be caused by other factors, such as different thermal coefficients for Ge and GaAs [19] The effect of Ge/GeMn ... wrote the manuscript All authors read and approved the final manuscript Acknowledgments The Australia Research Council, the Focus Center Research Program - Center on Functional Engineered Nano Architectonics...
  • 11
  • 318
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Natural regeneration of sessile oak under different light conditions" pptx

Báo cáo khoa học

... oak can take growth advantages before these species The failure of natural regeneration of oak can be then attributed particularly to browsing damage, insect (Tortrix viridana) damage, predation ... in the herb layer in the actual stand type In each of the stands, research polygon (RP) was established in such a way that it would represent the variability of stand conditions The actual natural ... conception of close-to-nature forest management The aim of the study was to determine the growth response of natural regeneration of oak (mast year in 2002) at different variants of regeneration...
  • 10
  • 327
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Variation in the molecular weight of Photobacterium damselae subsp. piscicida antigens when cultured under different conditions in vitro" pot

Báo cáo khoa học

... nehw aDk 22 naht rehtar aDk 42 ta dnuof erew sdnab ,revewoH aDk 74 ta dnab a htiw rehtegot ,MRG dna BST no derutluc airetcab no aDk 42 ta detceted saw dnab a saerehw ,airetcab evil tsniaga desiar ... dexim edirahccasylopopil fo ycaciffe ehT M iakaS ,H arahiK ,H atihsamaY ,Y adukuF ,N arahonihS ,H imakawaK 61 551-351 ,91 ,9991 lohtaP hsiF cossA ruE lluB adicicsip psbus alesmad muiretcabotohP ... serutxim eniccav levon gnisu ,adicicsip psbus alesmad muiretcabotohP tsniaga ,).L( xarbal suhcrartneciD ,ssab aes fo slairt noitaniccaV JG sidairtimiD ,A smadA ,M ittoelaG ,L inamsuG ,D ittaploV ,V...
  • 7
  • 334
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Interactive effects of irradiance and water availability on the photosynthetic performance of Picea sitchensis seedlings: implications for seedling establishment under different management practices" ppt

Báo cáo khoa học

... area were captured using a flat bed scanner and their area determined using Scion Imaging Software (Beta 4.0.1, Scion Corporation, Maryland, USA) Photosynthetic performance of Sitka spruce On ... performance of Sitka spruce 417 Figure Variation in maximum photosynthetic rate (Amax), stomatal conductance (Gs) and the ratio of internal to ambient CO2 concentration (Ci/Ca) for shoots from control ... 2.5 Diurnal gas exchange, chlorophyll fluorescence, shoot water potential and hydraulic conductance determinations Dark respiration rates, Amax and leaf water status at a saturating irradiance (200...
  • 10
  • 345
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "The angular distribution of diffuse photosynthetically active radiation under different sky conditions in the open and within deciduous and conifer forest stands of Quebec and British Columbia, Canada" pptx

Báo cáo khoa học

... of PAR under overcast and clear sky conditions For each analysis of variance, Tukey’s test was used to compare the means Analysis of variance was performed separately for each sky condition and ... global radiation This would explain the greater attenuation of PAR wavelengths compared to global radiation as the horizon is approached Under clear sky conditions, the angular distribution of ... formula with b set to explained nearly half of the sky variation obtained at a wavelength of 575 µm Grant et al [21] reported that PAR radiance was 5.6 times higher at the zenith than at the horizon,...
  • 11
  • 256
  • 0
Báo cáo khao học:

Báo cáo khao học: "High-resolution analysis of radial growth and wood density in Eucalyptus nitens, grown under different irrigation regimes" potx

Cao đẳng - Đại học

... measure distance over time, there is a common axis with the measured wood properties The axis of the dendrometer data is therefore rotated in a way that the radial distances of both measures are ... from a daily to a distance basis As an approximation, it was assumed that the production of phloem was more or less constant throughout the year The daily dendrometer data were rescaled so that the ... property data was mapped onto a daily time step, using the time and distance-based data arrays A critical step in the mapping process was the identification of growth ring boundaries The sufficiently...
  • 6
  • 341
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps

Báo cáo khoa học

... plantations make up more than 30% of the land area The plantations are highly productive, and therefore managed on short rotations (12–30 years) Intensive site preparation techniques are regularly ... other forest plantations [6, 15, 34] and may be a result of the increased supply of available carbon, and the higher temperature and moisture content, factors that favour a rapid increase in the ... microbial population Increased microbial biomass may also be favoured by mechanical disturbance of the soil by increasing the availability of carbon According to Salonius [35], disturbance of the...
  • 12
  • 312
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

Báo cáo khoa học

... repeated measurement component (γ was excluded ) n Linear regression analysis of SLA as a function of nutrient concentration was undertaken to compare the slope of the relationship among ... differences obtained for crown width and leaf biomass and area for the main stems indicate that competition reduced the aerial space occupancy of individual crowns and that the amount of foliage they supported ... of the contrasts was significant for the secondary stems (table II) Relative growth rate for both RCD and height of main and secondary stems decreased significantly with age and the age x spacing...
  • 13
  • 230
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Nutrient efficiency and resorption in Quercus pyrenaica oak coppices under different rainfall regimes of the Sierra de Gata mountains (central western Spain)" pps

Báo cáo khoa học

... neutral ammonium-acetate method [26]; available Ca and K using N ammonium acetate as extracting solution [37]; and available P using to the Bray-Kurtz [6] procedure Some of the important soil characteristics ... concentrations and the lowest of Ca, demonstrating a nutrient imbalance [27] Theoretically, the Ca and Mg composition of leaf litter is increased compared to leaf contents because of the loss of organic ... of the fact that there is four times as much available soil P at FG than at EP (table II) The usual clear relationship between available soil P (in Ah horizon) and P resorption does not exist any...
  • 11
  • 361
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Performance of young jack pine trees originating from two different branch angle traits under different intensities of competition" ppt

Báo cáo khoa học

... information still needs to be acquired on the effect of competition at young ages for jack pine In particular, there is a lack of information on the amplitude of competition in young stands that ... as a measure of the productive capacity of a plant [12], has been suggested as an alternative to absolute measures that could provide an adequate evaluation of the competitive status of trees and ... rate of change in stem dimensions These absolute measures indicated that the growth of stems and crowns and the amount of foliage decreased as the intensity of competition increased As they are...
  • 15
  • 234
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Height growth, shoot elongation and branch development of young Quercus petraea grown under different levels of resource availability" pptx

Báo cáo khoa học

... importance of the control on the axillary buds by the apical part of the shoot (Kramer and Kozlowski, 1979) Observations of the effects of the natural death of the apical bud during the winter, and ... stimulation of lateral branch development, the death of the apical bud may also cause a crooked stem form (Harmer, 1992b) In natural conditions, the death of the apical bud during the winter is not ... contrast, after years, branch formation was more important on the GUs from the late flushes The increased branch formation on the late flushes was a consequence of both a higher number of axillary...
  • 17
  • 240
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "of stem cuttings of Populus x euramericana under different water potentials" ppt

Báo cáo khoa học

... the observation that, during early development of roots, only cell elongation and cell division occur, and later on cell differentiation, lignification and hardening begin (Esau, 1960) Changes in ... initially and then increased gradually This decrease may be due to decreased water absorption by the cuttings until the functional roots were formed Grange and Loach (1983) opined that the decrease ... of y solute but exaggerated any rise of potential, due to the fall in ’P bark ofl:en associated with rises in osmotic potential of the expressed sap The relative conductivity decreased initially...
  • 3
  • 198
  • 0
báo cáo khoa học:

báo cáo khoa học: "Comparative analysis of root transcriptome profiles of two pairs of drought-tolerant and susceptible rice near-isogenic lines under different drought stress" doc

Báo cáo khoa học

... comparison of transcription activities between stressed condition and non-stressed (control) plants on the same oligoarray Hybridization solution was prepared with 825 ng each of Cy3- and Cy5-labelled ... Proline accumulation in roots of tolerant cultivars of rice starts earlier after the initiation of the stress treatment and was significantly more than their leaves [44] The expression patterns of ... and normalized according to the quantile method for standardization among array slides by EXPANDER version 5.0 [62] A gene was declared ‘expressed’ if the mean signal intensity of the gene was...
  • 50
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: " Validation of an ambulatory cough detection and counting application using voluntary cough under different conditions" potx

Báo cáo khoa học

... and assisted in the statistical data analysis, IK developed the hardware, SG evaluated the statistical data analysis and its presentation, NG oversaw the project and the manuscript preparation ... contribution of KarmelSonix' Data Archival and Validation Team:Anat Shkolyar, Diana Goldstein, Yelena Vivat, Janna Tenenbaum-Katan, Shoval Dekel and Ben Alpert Figure Bland-Altman Joint Distribution ... forces on the tracheal walls and pull them inwards to a partial collapse The cross section of the narrowed trachea further collapses and the flow velocity increases even more creating large shear forces...
  • 8
  • 303
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008