alfano c paolini g marchese c scuderi g 2002 transplantation of autologous cultivated conjunctival epithelium for the restoration of defects in the ocular surface scand j plast reconstr surg hand surg 36 6 340 348
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
... 5¢-d(GGATGTCCATATTA GGACAT)-3¢ reproduces the sequence of the SRF recognition element of the c- fos enhancer [2,27] The mutants SREGfos 5¢-d(GGATGTgCATATTAGGACAT)-3¢ and SREGGfos 5¢-d(GGATGTggATATTAGGACAT)-3¢ ... ´ Grzeskowiak K, Yanagi K, Prive GG & Dickerson RE (1991) The structure of B-helical C- G- A-T -C- G- A-T -C- G and comparison with C- C-A -C- G- T-T -G- G The effect of base pair reversals J Biol Chem 266 , ... water molecules and the internal dynamics in the speci c attachment of core-SRF to SREfos Results Electric charge distribution in SRE containing oligonucleotides at 10 C The electric charge distribution...
- 16
- 538
- 0
egbers c., pfister g. (eds.) physics of rotating fluids
... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings ... asymmetric Other symmetry-breaking points include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these ... disconnection of the single-cell states through a coalescence of the pitchforks between Figs (c) and (d) Thus along BD in Fig the pair of single-cell states are disconnected and this is the locus of limit...
- 445
- 774
- 0
Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients
... therapeutic range, necessitating the routine monitoring of its serum concentration to maximize the therapeutic effects and minimize toxicities [ 16- 19] Since digoxin is mainly eliminated via the kidneys, ... techniques and treatment recommendations Clin Pharmacokinet 1988; 15(3): 165 –179 Reuning RH, Geraets DR Digoxin In: Evans WE, Schentag JJ, Jusko WJ, eds Applied pharmacokinetics, principles of therapeutic ... investigate the effect of coadministered medications In summary, the usefulness of Cys -C was compared with Cr in terms of the estimation of the steady-state serum trough concentrations of digoxin...
- 5
- 523
- 0
Building C++CLI Programs for the .NET Developer Platform with Visual C++
... call string [mscorlib]System.String::Concat(string, string) IL_0017: ldloc.1 IL_0018: call string [mscorlib]System.String::Format(string, Hogenson_705- 2C0 3.fm Page 37 Friday, October 13, 20 06 ... System::Windows::Forms::MessageBox Listing 3-2 Using the #using Directive // using_directive.cpp #using "System.Windows.Forms.dll" using namespace System::Windows::Forms; int main() { MessageBox::Show("Hello ... nearly all classic C+ + code with the /clr option The C+ + language as extended by the C+ +/CLI language extensions is (for all practical purposes) a superset of the classic C+ +, so any C+ + application...
- 14
- 485
- 0
Gián án Test yourself c, review for the first term
... writing,listening,speaking B Method: Integrated, mainly communicative C Teaching aids:- Teacher: hand- outs,test paper,… D.Procedure; Teacher's activities Student's activities Checking the sts ... perfect continuous, past perfect continuous Skills: - main skill: reading - sub – skills: writing,listening,speaking B Method: Integrated, mainly communicative C Teaching aids:- Teacher :hand- outs,test ... the homework to at home - Prepare for indirect speech; Revise the rules of transforming directed into indirected date of teaching Class 1 2C2 Absent student 1 2C3 1 2C4 The 51st period Review for...
- 15
- 917
- 0
Tài liệu C for The Microprocessor Engineer P2 doc
... Accumulator can be directly incremented or decremented by using the INC or DEC instruction As noted, the X,Y,S,U registers can be similarly augmented by using the LEA instruction Notice that INC ... eight places) Instead of truncating, this 8-bit product may be rounded off by adding the MSB of Accumulator_B to Accumulator_A, in effect adding the bit To facilitate this, MUL sets the C flag ... instructions of ANDCC and ORCC for clearing or setting flags in the Code Condition register Thus to clear the I mask (see Fig 1.1) we have: ITS INSTRUCTION SET ANDCC #11101111b 27 ; Coded as 1C- EFh...
- 20
- 607
- 0
Tài liệu C for The Microprocessor Engineer P1 docx
... 8.8 Generating factorials using the else-if construct 228 8.9 Generating factorials using the switch-case construct 230 8.10 Generating factorials using a while loop 232 8.11 Generating factorials ... when executing the code of Table 5.3(b), viewed as word-oriented viii 10 128 LIST OF FIGURES 5.4 5.5 5 .6 5.7 The The The The 6. 1 6. 2 6. 3 6. 4 6. 5 6. 6 6. 7 6. 8 Detecting and measuring an asynchronous ... Mapping and Testing 412 15.9 A window into the hardware using an ICE 413 16. 1 A 68 09-based assembly-level coding 417 16. 2 A 68 008-based assembly-level coding 419 364 366 390 PART I Target Processors...
- 30
- 404
- 0
Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object
... mô t c a đ i tư ng ng S d ng đ i tư ng: ng: Khai báo l p b ng t khóa “class” Gi ng s d ng c u tr c tr c T m v c: c: T m nh hư ng, ph m vi ho t đ ng ng, ng C m c: public, private, protected c: ... trung tâm tâm Đ i tư ng xương s ng ng - C .Ư p - C .Kho Phương pháp l p trình hư ng đ i tư ng - Nguy n Minh Huy Verb Object L t Rau Ư p C N u - Ư p (C ) C ) - Kho (C ) C ) Hư ng đ i tư ng (object ... PhanSo.cpp ng, PhanSo cong(PhanSo p1, PhanSo p2) cong(PhanSo { // C i đ t c ng phân s } 10 S d ng đ i tư ng C+ + Ví d : so sánh đ i tư ng c u tr c tr c // S d ng đ i tư ng, file main.cpp ng, void main()...
- 22
- 538
- 5
Tài liệu Writing C Code for the 8051 pptx
... priorities: high and lo If, during the processing of an interrupt, another interrupt of the same priority occurs, the processor will continue processing the first interrupt The second interrupt will ... http://ubermensch.org/Computing/8051/code Sample Code Example code for the 8051 Microcontroller basic .c - A very basic example of writing C code for the 8051 int .c - A rewrite of the serial example to use interrupts ... DOS window and edit your program under C: For eg: 15 C: \Temp\count .c 16 Compile your programs 17 c5 1 count .c 18 c5 1 io .c This would generate object files: count.obj, io.obj 19 Link the object files...
- 52
- 535
- 1
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... permission in writing from the publisher Engineering Mechanics - Statics Chapter Problem 2-15 Resolve the force F into components acting along the u and v axes and determine the magnitudes of the components ... permission in writing from the publisher Engineering Mechanics - Statics Chapter Problem 1-4 Represent each of the following combinations of units in the correct SI form: (a) Mg/ms, (b) N/mm, (c) mN/( ... permission in writing from the publisher Engineering Mechanics - Statics Chapter Angle measured ccw from x axis 360 deg − φ + β = 353 deg Problem 2-4 Determine the magnitude of the resultant force FR...
- 1,119
- 1,071
- 2
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... by race and ethnicity Agriculture, forestry, fishing, and hunting Mining Construction Share of Share of Share of Foreign- foreignborn born Foreign- foreign- Foreign- foreignborn born Hispanic/ ... dwellings, except construction cleaning Landscaping services Architectural, engineering, and related services Accounting, tax preparation, bookkeeping, and payroll services Legal services Specialized ... production Mining Construction Manufacturing Miscellaneous manufacturing, n.e .c Cut and sew apparel manufacturing Furniture and related products manufacturing Printing and related support activities...
- 37
- 436
- 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... mode of bisphenol A in human ERRc TGGTGGTTA-3¢ (xxx ¼ gcg for Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu); 5¢-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3¢ (xxx ¼ gcg for Arg3 16 fi ... ball-and-stick structure, together with a space-filling structure in the ligand-binding pocket of the ERRc The space-filling structure of BPA originated from the X-ray crystal structure (Protein Data ... electrostatic interaction, hydrogen bonding, and the so-called NH ⁄ p interaction, Arg3 16 may play the main role in arresting and keeping the ligand in the pocket In uence of residual mutation of...
- 12
- 583
- 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
... tag was subsequently added to the resulting plasmid by cloning the following annealed oligonucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA ... the PCR duplex experiments The following primers 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene The ... into the SpeI- and EcoR1-digested p13R4 The same strategy was used for constructing p13R4-P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA...
- 14
- 483
- 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... is present in CHO cells throughout the time course of our experiments [10], neither changes in chromatin structure occurring during the cell cycle nor the passage of a replication fork render ... analyzed for recombination by Southern blotting using a probe speci c for the N-terminal region of the lacZ gene (compare Fig 2A) The results show that Cre efficiently recombines the genomic substrate ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds...
- 7
- 472
- 0
Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt
... sequence d(GGGTTAGGGTTAGGGT) in Na+ solution [30] (E) Asymmetric dimeric (3 + 1) G- quadruplex association observed for the three-repeat human telomeric sequence d(GGGTTAGGGTTAGGGT) and the single-repeat ... observed for d[A(GGGTTA)3GGG] in a K+-containing crystal [27] (H) (3 + 1) Form observed for d[TA(GGGTTA)3GGG] in K+ solution [39–44, 46] (I) (3 + 1) Form observed for d[TA(GGGTTA)3GGGTT] in K+ solution ... recognition of higher-order G- quadruplex by chiral cyclic-helicene molecules Nucleic Acids Symp Ser 50, 183–184 97 Chang CC, Kuo IC, Ling IF, Chen CT, Chen HC, Lou PJ, Lin JJ & Chang TC (2004) Detection...
- 11
- 480
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... regulated by cytosolic injections of PKA activators and inhibitors, suggesting it to be the basis for the functional effects of cAMP injections on GIRK currents PKA-induced phosphorylation of the ... regulation of GIRK1 and GIRK4, the two subunits of the K-ACh channel, using functional homomeric mutants J Biol Chem 272, 31553–31 560 McConnachie G, Langeberg LK & Scott JD (20 06) AKAP signaling complexes: ... SpCAMPS, RpCAMPS or nothing (control) was injected into the oocytes the oocytes ), native oocytes; +, oocytes injected with RNA encoding GIRK1 and GIRK4 phosporylated already in the oocytes before...
- 9
- 403
- 0
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx
... (GH 262 ) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ (GH 263 ), the MUC5AC-encoding sequence could be amplified by PCR 45M1, a human mAb against MUC5AC The primer GH 262 introduced ... into a pBluescript vector, was used as template for the amplification of the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH 262 ) ... template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ (GH287) and 5¢-GCGAGGTCTC TGTGG CGGTA TATGGTG-3¢ (GH288), the 5¢-part missing in the L31 clone could be...
- 9
- 330
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR product was cloned into the ... insertion into the Gateway donor vector pDONR201 (Invitrogen, Gaithersburg, MD) by homologous recombination A sequence (GATGACGACGACAAG) corresponding to the enterokinase cleavage site (DDDDK) was included ... Escherichia coli The recombinant protein contained an engineered enterokinase cleavage site in the junction between the GST tag and the Rv1771 sequence Upon h of induction of the pDEST15_Rv1771 E coli...
- 11
- 571
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC ... sites containing primers (sense: 5¢-TAG CGG ATC CGA GCC TCA GGT GTC AAA TGG-3¢; antisense: 5¢-AAT GCC CGG GTC AGG ACT TGT GGG CTT TGT-3¢) The plasmid kuniZAP- 265 114, kindly provided by M Kock, ... proteins identified (Fig 3C) interact specifically with the CU-rich sequence Binding of ELAV/Hu proteins to the MARCKS 52 nt CU-rich RNA One of the identified proteins binding to the MARCKS CU-rich...
- 16
- 754
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25