adult stem cells as a treatment for liver diseases nata amp 353 a levi amp 269 ar
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf
... cartilage Mostly hyaline cartilage Mostly fibrocartilage Mostly non-cartilage Noncartilage only Matrix-staining (metachromasia) Normal (compared with host adjacent cartilage) Slightly reduces Markedly ... were analyzed using a grading system consisting of five categories (cell mor- 15 aTotal smooth area of the reparative cartilage compared with the entire area of the cartilage defect bAverage thickness ... the reparative cartilage compared with that of the surrounding cartilage Page of 10 (page number not for citation purposes) Arthritis Research & Therapy Vol 10 No Koga et al knee arthroplasty with...
- 10
- 470
- 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... WJ and Carey 2008) 4T1 mammary carcinoma cell line is a suitable experimental animal model for human mammary cancer When introduced orthotopically, it is capable of metastasis to several organs...
- 134
- 439
- 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... Control base media Control base media + DMSO Treatment Treatment Treatment Treatment Treatment Treatment Treatment Treatment Day0 + - Day2 + + - Purmorphamine treatment Day4 Day6 Day8 Day10 + + ... lines for hours following ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase...
- 117
- 385
- 0
Báo cáo y học: "Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus" pps
... secondary to cellular activation [116] Interestingly, medications that can cause drug-induced lupus (e.g hydralazine and procainamide) are capable of blocking methyltransferase activity [117], and ... Feature Class B Class R All TLR9+ cells MZ-B, DC, MF Potency Nanomolar Nanomolar Structure Linear–primary Secondary Backbone PS PS or SOS Effect on BCR signaling No Yes(?) in anti-dsDNA B cells ... mammalian DNA are methylated; however, even after complete demethylation, mammalian DNA is still poorly stimulatory • Inefficient uptake: uptake of mammalian DNA into immune cells mediated via...
- 11
- 552
- 0
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation acted as a physical barrier to the growth of anatomically ... expressed as medians for Olby scores and the means ± SD for SEP values and Luxol fast blue positive areas Statistical analysis used SPSS 12.0 software (SPSS, USA) Kruskal-Wallis analysis for Olby ... dexamethasone (Sigma-Aldrich, USA), 50 μM l-Ascorbate2-phosphate (Sigma-Aldrich, USA), and 10 mM betaglycerophosphate (Sigma-Aldrich, USA)] for weeks [14] Mineralization was assessed by staining...
- 12
- 309
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most frequently ... joint-specific autoimmune disease Nat Immunol 2002, 3:360-365 Felson DT, LaValley MP, Baldassare AR, Block JA, Caldwell JR, Cannon GW, Deal C, Evans S, Fleischmann R, Gendreau RM, Available online http://arthritis-research.com/content/5/3/131 ... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct...
- 5
- 410
- 0
Báo cáo y học: " Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment" pdf
... promote cartilage degradation and stimulate further joint inflammation (4) and a self-perpetuating inflammatory and catabolic cascade develops As illustrated, cartilage contains chondrocytes and MSC-like ... where cartilage damage is marginal Abbreviations AP30 3a: alkaline phosphatase linked sheep anti-mouse; AP30 4A: sheep antirabbit secondary antibodies; DMSO: dimethylsulfoxide; COX-2: cyclooxygenase-2; ... longa is a promising therapeutic agent for the treatment of OA and RA as it has pro-apoptotic properties in synovial lining cells [33,34] and has been shown to have anti-inflammatory and anti-apoptotic...
- 15
- 328
- 0
Báo cáo y học: "Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis" pps
... undisturbed for three to four days to allow migration of cells from the explants, at which point the media was replaced They were re-fed and passaged as necessary After three passages, the cells were harvested ... integrity and ankylosis Each joint was scored separately by two individuals unaware of the treatment protocol To trace the migration of transplanted cells in vivo, analysis with mAb against human nuclei ... for alkaline phosphatase Arrows indicate the accumulation of intracytoplasmic alkaline phosphatase of osteoblast Original magnification × 40 involved in the suppression of UC-MSCs on FLSs (data...
- 13
- 297
- 0
Báo cáo y học: "Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity" pps
... Blbp Pax6 TGCACCACCAACTGCTTAG CTGTAACCGGCGCCAGAA GGCCAACGAATTGGATTCTA TGGCCAGAGGCATGGAGT CCAAGCTCAGCACACAAAAA CCCACCGGATGGCTAGGTATT ACCTGACAGGGAAGATGGTG CTGGGAGTGTGCAGATATCAGAGT AACCTCAGCACCAATGTTCC ... CAGCTATGAGGAGGCCTTTG TTAAGTCCAATGCGGACCTC GCCCTACAGACCATGAAACAAG CTTTGCCTCTGGGAAGACC CCCGGGACTTAACTGTAACG GGTCAAGCTACGAGGACAGC CTTCAGGGGACAAGAGTTCG CACAACGCAGAGCTAAGCAA CTGTGTGGAGTCCTCAGGTCAAACC ... CAGCAGTGGTGCTGTAGGAGTA AACCCCAAGATGCACAACTC GTTCGCAAAGACTCGCTACC CCAGCTGGGAGAAGAGTTTG GTCCATCTTTGCTTGGGAAA GATGCAGGGATGATGTTC TGCATGGGAGAGCCCAGA GTTTACTGGCACCACGTCCT TCGCAAATCTTCACCACATTG CCAACCACTCTGGGAACTGT...
- 20
- 301
- 0
Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps
... MYC activation in high-grade papillary renal cell carcinoma Cancer Res 2007, 67:3171-3176 Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, Hirakawa M: ... Varambally S, Barrette TR, Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM: α-Methylacyl coenzyme A racemase as a tissue biomarker for prostate cancer JAMA 2002, 287:1662-1670 Stuart RO, Wachsman W, ... Gene Scanner 3000 The raw data are available in the ArrayExpress Database (accession E-MEXP-993) signature When comparing malignant against benign samples very few probesets were significantly...
- 13
- 682
- 0
The roles of rac1 and syncollin in regulated exocytosis insulin secreting INS 1 cells as a model
... channels, leading to the membrane depolarization and Ca2+ entry (McClenaghan et al., 1996) Basic amino acids such as arginine are able to directly depolarize β -cells, thereby facilitating Ca2+ ... Shirsat et al., 1990) Different mammalian Rho GTPases are at least 40% identical to each other at the amino-acid level, whereas they are approximately 25% identical to Ras To date, only Rho, Rac, ... β, and γ These proteins are signal transducers that communicate signals from many hormones, neurotransmitters, chemokines, as well as autocrine and paracrine factors The extracellular signals are...
- 140
- 249
- 0
MESENCHYMAL STEM CELLS AS THERAPY AGAINST HUMAN GLIOBLASTOMA MULTIFORME
... with death domain (FADD) and pro-caspase (proCASP8), enabling cleavage and activation of proCASP8 to its active form caspase (CASP8) CASP8 activates downstream effector caspases both directly and, ... higher malignancy > years Anaplastic astrocytoma III Malignant; High proliferative potential; Presence of nuclear atypia, anaplasia and mitotic activity 2-3 years Glioblastoma multiforme IV Similar ... appearance of a glioblastoma, characterized by nuclear pleomorphism, dense cellularity, and pseudopallisading necrosis (asterisk; Panel A, hematoxylin and eosin) as well as vascular endothelial...
- 132
- 116
- 0
Adult Stem Cells full bản đẹp
... Hematology, Institute of Medical and Veterinary Science, Adelaide, South Australia, Australia MASATOSHI HARUTA • Translational Research Center, Kyoto University Hospital, Kyoto, Japan JOHNNY HUARD ... hydra, planarian, mollusks, insects, crustaceans, and echinoderms (starfish) Chordates that can regenerate include amphibians such as frogs and salamanders Almost every phylum has species that are ... transient nature of the increase in Apale after more than d after irradiation can be explained by assuming that, after the decline in Apale numbers, the Adark spermatogonia are activated The activation...
- 361
- 381
- 0
Báo cáo y học: "Chlamydia trachomatis diversity viewed as a tissue-specific coevolutionary arms race" pot
... Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H: Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory ... of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR3 9 Nucleic Acids Res 2000, 28:1397-1406 SWAAP 1.0.2 software [http://www.bacteriamuseum.org/ SWAAP/SwaapPage.htm] Kumar S, Gadagkar SR: ... estimate evolutionary distances (Kimura 2-parameter (K2P), Jukes-Cantor or Tamura-Nei) as well as for the maximum parsimony method (data not shown), with only slight variations in the bootstrap values,...
- 13
- 258
- 0
Báo cáo sinh học: "Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" doc
... of interdisciplinary transplant medicine has made liver transplantation a standard-of-care clinical therapy for end-stage liver disease Long-term side effects of organ transplantation with chronic ... lymphoproliferative disease and hepatocellular carcinoma) except for squamous or basal cell carcinoma of the skin that has been treated with no evidence of recurrence Unstable myocardium (evolving myocardial ... contrast, pulmonary function tests, and arterial blood gas analysis Intraoperative data (warm and cold ischemia Popp et al Journal of Translational Medicine 2011, 9:124 http://www.translational-medicine.com/content/9/1/124...
- 10
- 451
- 0
báo cáo hóa học:" Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" pptx
... of interdisciplinary transplant medicine has made liver transplantation a standard-of-care clinical therapy for end-stage liver disease Long-term side effects of organ transplantation with chronic ... lymphoproliferative disease and hepatocellular carcinoma) except for squamous or basal cell carcinoma of the skin that has been treated with no evidence of recurrence Unstable myocardium (evolving myocardial ... contrast, pulmonary function tests, and arterial blood gas analysis Intraoperative data (warm and cold ischemia Popp et al Journal of Translational Medicine 2011, 9:124 http://www.translational-medicine.com/content/9/1/124...
- 10
- 438
- 0
báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot
... health-care resources Therapy with CCR5-negative stem cells In the early 1980s, alloHSCT appeared to be attractive as a therapy for HIV in patients with advanced disease because it was thought to substitute ... caucasian population, with the highest frequency being reached in the north-eastern parts of Europe [11] It is largely absent in Africa, as well as in eastern and south-eastern Asia Prevalence ... CCR5delta32 status appears to have several beneficial effects on the alloHSCT setting: previous analyses revealed that the CCR5-delta32 allele appears to protect against acute graft versus host disease...
- 5
- 206
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... Arthritis Research Vol No Horwitz et al can serve as a therapy for autoimmune diseases such as systemic lupus erythematosus (SLE) This T-cell-based therapy could also be used to prevent graft ... in autoimmune diseases characterized by a relapsing and remitting course such as SLE, inflammatory bowel disease or certain forms of multiple sclerosis The adoptive transfer of regulatory T cells ... generated ex vivo also has the potential to prevent the rejection of allogeneic organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI...
- 6
- 408
- 0
Báo cáo y học: " Chinese medicines as a resource for liver fibrosis treatment" ppsx
... miltiorrhiza ameliorates carbon tetrachloride-mediated hepatic apoptosis in rats J Pharm Pharmacol 2006, 58:659-65 Yamamura Y, Kotaki H, Tanaka N, Aikawa T, Sawada Y, Iga T: The pharmacokinetics of ... Zingiberis, Ramulus Cinnmomi, Radix Aconiti Lateralis preparata, Radix Astragali, Radix Bupleuri, Fructus Aurantii, Rhizoma Atractylodis macrocephalae, Radix Glycyrrhizae Radix Salvia miltiorrhizae, Cordyceps ... Rhizoma Alismatis Largehead Atractyloidis Rhizoma, Hoelen, Aurantii Nobilis Pericarpium, Radix Ginseng, Radix Scutellariae, Magnolia Bark, Alisma Rhizoma, Radix Ophiopogonis, Atractylodis Rhizoma...
- 11
- 428
- 0
Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model
... necrosis factor-α VCAM vascular cell adhesion molecule VE-cadherin vascular endothelial cadherin VTA ventral tegmental area ZO zonula occludens SUMMARY xix Summary Neurodegenerative disorders such as ... reaction PD Parkinson’s disease PF paraformaldehyde PGE2 prostaglandin E2 PINK1 PTEN-induced kinase PPARγ peroxisome proliferators-activated receptor γ PQ paraquat RA all-trans-retinoic acid Rae-1 retinoic ... recycling, storage and compartmentalization of neurotransmitters and associates with vesicular and membranous structures (Cabin et al., 2002) Alpha-synuclein has an increased propensity to aggregate due...
- 200
- 311
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25