adding an element to a hash
o'reilly - perl cookbook
... low-level language; lines and strings are easy to handle Perl was designed for text manipulation In fact, Perl can manipulate text in so many ways that they can't all be described in one chapter Check ... data is the scalar, that is, single values stored in single (scalar) variables Scalar variables hold strings, numbers, and references Array and hash variables hold lists or associations of scalars, ... shall be last and versa vice You can even exchange more than two variables at once: ($alpha, $beta, $production) = qw(January March August); # move beta to alpha, # move production to beta,...
- 1,096
- 1,310
- 0
Báo cáo y học: " Autonomic Dysfunction Presenting as Postural Orthostatic Tachycardia Syndrome in Patients with Multiple Sclerosis"
... BP, Kanjwal Y, Kosinski DJ The postural tachycardia syndrome: A concise guide to diagnosis and management J Interv Card Electrophysiol 2006; 17:108–112 Acevedo AR,Nava C, Arriada N, Violante A, ... Pomeranz B, Macaulay RJ, Caudill MA, Kutz I, Adam D, Gordon D, Kilborn KM, Barger AC, Shannon DC, Cohen RJ, et al Assessment of autonomic function in humans by heart rate spectral analysis Am J ... Demyelinating plaques may disrupt reflex pathways in the insular, cingulated and ventromedial prefrontal cortices, central nucleus of the amygdala, paraventricular hypothalamus and the medulla In addition...
- 6
- 478
- 0
Functions with multiple outputs
... performance; can use random pivot • Divide and conquer algorithm; easily parallelizeable • Recursive; in worst case, can cause stack overflow on large array 29 Searching a sorted array • Searching an ... algorithms • Can make good use of pointers • Just a few examples; not a course in algorithms • Big-O notation 21 Searching an array • Suppose we have an array of int’s int arr [100]; /∗ array to search ... Physical memory: physical resources where data can be stored and accessed by your computer • • • • cache RAM hard disk removable storage • Virtual memory: abstraction by OS, addressable space accessible...
- 41
- 184
- 0
Tài liệu Adding Records with a GUID Primary Key pdf
... handlers to generate new GUIDs for primary keys parentTable.RowChanging += new DataRowChangeEventHandler(parentTable_RowChanging); childTable.RowChanging += new DataRowChangeEventHandler(childTable_RowChanging); ... // Add the tables to the DataSet and create the relationship ds = new DataSet( ); ds.Tables.Add(parentTable); ds.Tables.Add(childTable); ds.Relations.Add(new DataRelation("Parent_Child_Relation", ... DataRowChangeEventHandler(childTable_RowChanging); } private void parentTable_RowChanging(object sender, DataRowChangeEventArgs e) { if(e.Action == DataRowAction.Add) ds.Tables[PARENTTABLENAME].Columns[ PARENTID_FIELD].DefaultValue...
- 4
- 340
- 0
Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc
... Translation P Liang, A Bouchard-Cote, D Klein, and B Taskar 2006 An end -to- end discriminative approach to machine translation In ACL Ding Liu and Daniel Gildea 2007 Source-language features and ... Shai ShalevShwartz, and Yoram Singer 2006 Online passiveaggressive algorithms Journal of Machine Learning Research, Kalyanmoy Deb, Amrit Pratap, Sammer Agarwal, and T Meyarivan 2002 A fast and ... Translation Sebastian Pado, Daniel Cer, Michel Galley, Dan Jurafsky, and Christopher D Manning 2009 Measuring machine translation quality as semantic equivalence: A metric based on entailment features...
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: "Extending the Entity-based Coherence Model with Multiple Ranks" pot
... on the topic of earthquakes (Earthquakes) and narratives on the topic of aviation accidents (Accidents) A training data instance is constructed as a pair consisting of a source document and one ... insignificant for Accidents This is most probably due to the different way that entities are realized in these two datasets As analyzed by Barzilay and Lapata (2008), in dataset Earthquakes, entities ... of Toronto 323 References Michele Banko and Lucy Vanderwende 2004 Using n-grams to understand the nature of summaries In Proceedings of Human Language Technologies and North American Association...
- 10
- 363
- 0
Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot
... information in machine translation In (Iida and Arita 1990; Kogura et al 1990), researchers at ATR advocate an approach to machine translation called illocutionary act based translation, arguing ... than as a simple stack A graph structured stack is a stack which can have multiple top elements at any point Because it is possible to maintain more than one top element, it is possible to separate ... expression evaluator checks to see that it is acceptable to make that attachment according to the annotations in the plan operator of which this new action would become a child If an action on the active...
- 8
- 266
- 0
Discovering Frequent Event Patterns with Multiple Granularities in Time Sequences docx
... of a complex event type in an event sequence In order to so, we define a variation of the timed automaton [4] that we call a timed automaton with granularities (TAG) A TAG is essentially an automaton ... 68–78, ACM Press, New York, 1996 C Bettini, X Wang, and S Jajodia, A General Framework for Time Granularity and Its Application to Temporal Reasoning,” Annals of Mathematics and Artificial Intelligence, ... theory, query languages and query optimization, databases with sequential data such as temporal and sequence, as well as multidimensional databases Dr Wang is a member of the ACM and the IEEE Computer...
- 16
- 395
- 0
Báo cáo khoa học: "American Sign Language Generation: Multimodal NLG with Multiple Linguistic Channels" pot
... other graphics, and sound effects An ECA system may have separate channels for eye gaze, facial expression, manual gestures, and speech audio of the animated character When a language has no commonly-known ... of a speaking ECA character that performs meaningful gestures (Kopp et al., 2004) has similarities to this ASL project First of all, the channels in the signal are basically the same; an animated ... North American chapter of the Association for Computational Linguistics annual meeting: HLT/NAACL 2004, Boston, MA, USA Huenerfauth, M 2004b Spatial and Planning Models of ASL Classifier Predicates...
- 6
- 200
- 0
Báo cáo khoa học: "DEDUCTIVE PARSING WITH MULTIPLE LEVELS OF REPRESENTATION*" pptx
... human's knowledge of a language and the knowledge of the utterances of that language that they induce can be formally described as follows: we regard Universal Grammar as a logical theory, i.e a ... possible to construct parsers that use the same knowledge of language in a bottom-up fashion The PAD3 parser uses the same parameter values and lexicon as PAD1 and PAD2, but it uses a reaxiomatization ... set of statements expressed in a specialized logical language, and the lexicon and rarameter values that constitute the specific knowledge of a human language beyond Universal Grammar as a set of...
- 8
- 269
- 0
Assessment and Management of the Elderly Patient with Multiple Sclerosis pot
... opioid analgesics, nonsteroidal anti-inflammatory drugs (NSAIDS), antiseizure medication, antidepressants anti-spasticity agents, and cannabinoids An intrathecal pump may also be beneficial for pain ... spasticity, ataxia, heat intolerance, fatigue, pain, and bowel and genitourinary dysfunction As the patient with MS ages, morbidities and p hysiological changes associated with the normal aging ... stroke, gastrointestinal bleeding, and renal insufficiency.22 Carbemazapine and other anticonvulsants may also increase confusion and ataxia in the elderly Tricyclic antidepressants (TCAs) or other...
- 11
- 508
- 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ... GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR ... (5¢- to 3¢) P1 GTACTATTGGATCCATGCTGACG P2 GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT...
- 12
- 462
- 0
Báo cáo khoa học: "Joint Decoding with Multiple Translation Models" docx
... Combination Hypergraphs have been successfully used in parsing (Klein and Manning., 2001; Huang and Chiang, 2005; Huang, 2008) and machine translation (Huang and Chiang, 2007; Mi et al., 2008; Mi and ... translation Computational Linguistics, 33(2) Haitao Mi, Liang Huang, and Qun Liu 2008 Forestbased translation In Proc of ACL08 Franz J Och and Hermann Ney 2002 Discriminative training and maximum ... statistical machine translation In Proc of ACL08 David Chiang 2005 A hierarchical phrase-based model for statistical machine translation In Proc of ACL05 David Chiang 2007 Hierarchical phrase-based...
- 9
- 295
- 0
Imputation Methods to Deal with Missing Values when Data Mining Trauma Injury Data pot
... different approaches to the statistical analysis of these data were carried out; data mining using an artificial neural network (ANN) and logistic regression modelling (LR) All analysis was carried out ... training datasets and five corresponding validation datasets Each of the three imputation methods described above are applied to each of these ten datasets and results are compared for the ANN and ... not lead to more accurate classification of patient death or survival following trauma injury than the complete-case analysis, they allow classification of patients whose Glasgow coma scores are...
- 6
- 510
- 1
Báo cáo khoa học: "Text Segmentation with Multiple Surface Linguistic Cues" pptx
... better to determine the weights automatically, because it can avoid the need for expert hand tuning and can achieve performance that is at least locally optimal We use the training texts t h a t are ... Watanabe(Watanabe, 1996) can be considered as a related work He describes a system which automatically creates an abstract of a newspaper article by selecting important sentences of a given text He applies ... Kvxlokawa in Japanese R.J Passonnean and D.J Litman 1993 Intentionbased Segmentation: Human Reliability and Correlation with Linguistic Cues In 51st Annual Meeting of the Association for Computational...
- 5
- 181
- 0
Báo cáo khoa học: "TEXT UNDERSTANDING WITH MULTIPLE KNOWLEDGE SOURCES: AN EXPERIMENT IN DISTRIBUTED PARSING" docx
... to correctly complete the task, it will send back to the CM a message containing an alarm, causing in such a way a change in the priority of the semantic analysis problem, that will become Fatal ... appropriate quantifier to attach to each concept in the BLR/ELR To: SES From: CM Problem: Semantic Analysis On: < the current sentence > Priority: Auxiliary Also the message requesting semantic analysis ... to complement semantic analysis with available syntactic information (and viceversa) in order, for example, to resolve ambiguities The 77me Specialist (TS) is able to attach to each proposition...
- 5
- 217
- 0
channel adaptive technologies and cross layer designs for wireless systems with multiple antennas
... model A general model of transmission and causal partial feedback strategies for block fading channels General structure of an adaptive channel encoder General structure of an adaptive channel ... RRC layer and other protocol components State transition diagram of RRC layer A summary of transport channel mappings to support data radio bearer in UMTS An example of packet-switched data connection ... Modulation nT antennas Transmitter with nT antennas and no feedback Figure P.1 Architecture of multiantenna transmitter without feedback approach to elaborate on the adaptive physical layer design...
- 544
- 313
- 0
báo cáo hóa học: "The impact of regular physical activity on fatigue, depression and quality of life in persons with multiple sclerosis" pot
... the individual The MFIS has been suggested as a useful measure of fatigue in MS research and clinical practice [30] Data analysis Data was analysed using the statistical software package SPSS version ... perform any analysis to confirm this Data was collected in a de-identified manner and we were unable to provide information on responders vs nonresponders and we cannot guarantee that the sample ... visible abnormality of gait; = early cane, intermittent use of a cane; = late cane, cane dependant; = bilateral support; = confined to a wheelchair Although the DSS is a self administered questionnaire,...
- 10
- 683
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008