activation of the glass surface with aptes steps 1 3 coating the walls of t
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... acids 6 23 645) ICDs MT1-MMP (VP16MT1 Y, VP16-MT1 LL, VP16-MT1 FRR, VP16-MT1 HGT, VP16-MT1 PRR, VP16-MT1 LLY, VP16-MT1 CQR, VP16-MT1 SLL, VP16-MT1 DKV), MT2-MMP (VP16-MT2 LLY), MT3-MMP (VP16-MT3 ILY) ... 2 010 FEBS C Roghi et al Role of GRASP55 in MT1-MMP activation ting that the disruption of the interaction between MT1-MMP and GRASP55 could affect the activation of the protease Taken together, ... (2 010 ) 31 5 8– 31 7 5 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 31 7 3 Role of GRASP55 in MT1-MMP activation 32 33 34 35 36 37 38 39 40 41 42 C Roghi et al Src-dependent phosphorylation of...
- 18
- 603
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... of the MAP kinase activation loop [3 ,14 ,18 ], Y2H interaction of these MAP kinases with the two isoforms of human Hsp90 was strengthened by heat shock (Fig 5A) The stronger interaction of ERK5 with ... that altered resistance can arise with mutation to Hsp90, with altered cochaperone function and with the loss of plasma membrane drug efflux pumps [35 ] The results of this study point to the two ... existing as multichaperone complexes with high affinity for client proteins, rather that as the latent uncomplexed chaperone The ATPase reaction of Hsp90 is thought to constitute the rate-limiting...
- 11
- 427
- 0
báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc
... %CD70+ 219 5 7770 40924 13 .2 5.0 10 8 759 2749 1. 6 0.6 4 4 13 17 726 90576 61. 1 30 .3 368 14 99 33 33 5 .1 3. 3 10 417 209 93 86 918 75.8 34 .8 10 03 2504 38 47 4.9 3. 8 10 622 26777 9 639 7 82.8 41. 3 804 4267 6585 3. 5 ... 5 91 4979 3. 3 2.6 38 67 232 21 82 839 58.6 33 .5 265 2098 4675 5 .3 4.8 8828 2 716 5 838 56 73. 8 39 .2 738 2026 47 03 4.4 6 .1 1 030 8 40067 10 816 1 82.6 51. 2 776 34 81 5250 3. 4 5.9
- 10
- 624
- 0
báo cáo hóa học: " The effects of powered ankle-foot orthoses on joint kinematics and muscle activation during walking in individuals with incomplete spinal cord injury" pptx
... 0 . 13 1. 57 ± 0 .15 1. 49 ± 0 . 13 1. 42 ± 0.09 1. 31 ± 0.08 1. 35 ± 0 .11 1. 34 ± 0.07 Stance Time (s) 0.7 611 P = 0 .10 1. 26 ± 0 .19 1. 18 ± 0 .15 1. 26 ± 0 .15 1. 01 ± 0 .11 0.98 ± 0 .10 0.99 ± 0 .10 0.92 ± 0.09 ... large of a cognitive effort Even the two subjects who could control the orthoses themselves did not match the performance of the thera- http://www.jneuroengrehab.com/content /3 /1/ 3 pist Both orthoses ... swing initiation during walking Journal of Biomechanics 20 01, 34 : 13 87 - 13 98 http://www.jneuroengrehab.com/content /3 /1/ 3 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Gottschall...
- 17
- 450
- 0
báo cáo hóa học: " Activation of retinal microglia rather than microglial cell density correlates with retinal neovascularization in the mouse model of oxygen-induced retinopathy" ppt
... Page of 8 10 11 12 13 14 15 Authors’ contributions FF carried out the histological studies, counted microglia, provided pictures and drafted the manuscript GM participated in the design of the study ... neovascular tufts on the vitreal surface of the retina [19 ] Therefore, it was speculated that microglial cells are involved in vascular tuft formation But as they are not activated (Figure 5), their ... periods: first after the start of the hyperoxic phase from P8 to P12 and again during the late hypoxic phase from P16 to P18 (Figure 3) In both periods, they were detected only within the superficial...
- 8
- 353
- 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
... nodes 2 ,3 In either case, the degree the electronic journal of combinatorics 18 (2 011 ), #P 91 31 2 34 o Figure 52 of node is larger than This contradicts our assumption in the section that the degree ... part of picture 10 Note the replacement for picture is the same as the replacement for picture 10 Therefore, whether node o in picture or 10 is examined first does not affect the result of the algorithm ... are in the upper or lower triangle of the diamond This forces d to be contained in the diamond Notice that since the node x is not connected with p, the other half of the electronic journal of combinatorics...
- 45
- 262
- 0
Báo cáo y học: "The appropriateness of single page of activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction: a cohort study" doc
... delay in treatment; these include extended time between the onset of symptoms and the patient’s recognition of them, transport to the hospital, and treatment at the emergency department Delays during ... Investigators: Effect of door-to-balloon time on mortality in patients with ST-segment elevation myocardial infarction J Am Coll Cardiol 2006, 47 (11 ): 218 0-6 10 11 12 13 14 15 16 17 18 Page of Bradley ... activation of the CCL between August 2009 and April 2 011 were included in the study A total of patients were excluded because they were transferred from another hospital after the diagnosis of...
- 6
- 232
- 0
The effect of sulphuric acid activation on the crystallinity, surface area, porosity, surface acidity, and bleaching power of a bentonite
... decreases when the mass-percentage of H2SO4 in the acid treatment exceeds 10 % However, the crystal structure of the smectite is still partly preserved even after activation with a H2SO4 content of 50% ... controlled by the PSD, rather than the other adsorptive properties As to oil retention characteristics of the natural and acid-activated bentonites, the natural material is found to have trapped ... mass The crystallinity of the non-clay minerals are not affected by the acid activation process 3. 2 Nitrogen adsorption and desorption isotherms The N2 adsorption/desorption isotherms at the liquid...
- 8
- 765
- 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... we hypothesized that activation of the MET service at our institution would cluster around these times To test this hypothesis we analyzed the frequency of MET activation at half-hourly intervals ... During these periods, activation of the MET service was 1. 25 times more likely (95% CI = 1. 11 1. 52) when compared with the average activation over the 24-hour period (P = 0.0 01) The highest level of ... not staffed by parent unit doctors In addition, there was a trend toward increased frequency of activation of the MET service during these hours in the years following the introduction of the...
- 4
- 541
- 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf
... 5C) Taken together, these data indicated that JSP1-wt, but not the -G2A mutant, induced detachment of cells and induction of apoptosis, further demonstrating that the myristoylation mutant was ... expressing the JSP1-G2A mutant remained attached to the dish despite the fact that the mutant protein was expressed at similar levels to those of the wild-type protein that was encountered in the floating ... error of the mean) GFP in the cytoplasm and nucleus, excluding the possibility that the distinct localization of JSP1-wt could be due to the attached tag (Fig 3) This suggested that myristoylation...
- 11
- 580
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... alternative conformations suggests that the Trp1 91 Met195 couple is the main active site gating determinant controlling ligand admission Crystal structure of human ACMSD w1 DHAP Met 19 5 Trp 19 1 ... indicated by dotted lines, together with the hydrogen bonds established by DHAP with the metal-coordinating solvent molecule w1 The portion of the 2Fo)Fc electron density map covering the DHAP ... clearly indicated the presence of a Zn metal ion bound to the enzyme Analysis of the diffraction data set allowed us to assign the crystal to the trigonal P32 21 or P 31 2 1 space group, with ˚ ˚ cell...
- 9
- 796
- 0
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt
... WT receptor are consistent with such a mechanism The most parsimonious explanation of the loss of the potentiating effect in the mutant receptor is that the mutation results in the loss of the ... conformation as the equivalent domain in the native receptor, it is difficult to correlate the two sets of results The apparent affinity of the competitive antagonist, dTC, was measured by its ability to inhibit ... remained statistically different Taken together, these results suggest that, in the WT receptor, an interaction between aR55 and cE 93 is unlikely to stabilize either the resting conformation (as the...
- 11
- 517
- 0
Tài liệu Báo cáo Y học: The solution structure and activation of visual arrestin studied by small-angle X-ray scattering pot
... proportional to the product of the molecular mass and concentration of the scattering particle For a mixture of particles, the total forward scattering, I(0)total is equal to the sum of contributions ... plotted as a function of the momentum transfer: the AA dimer has the best agreement in the lower angle region, up to S ¼ 0 .3 nm )1 Within the crystal structures of arrestin, the AA dimer is the ... relates the protein concentration to the forward scattering using the Kd as the single variable Using this equation, it was found that the Kd was 40 ± 20 lM Other fits to the data were also tested...
- 9
- 492
- 0
Báo cáo khoa học: Small-molecule modulators of zymogen activation in the fibrinolytic and coagulation systems pptx
... activation modulators 98 99 10 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 to hepatocyte growth factor activator J Biochem 11 9, 11 57 11 65 Etscheid M, Hunfeld A, Konig H, Seitz R & Dodt J (2000) Activation of ... explained by the fact that the impact of the conformational effect depends on the initial conformational status of plasminogen With respect to the conformational modulation that leads to an elevated Gluplasminogen ... inhibits the autoactivation The experiments aided by a series of domain-deletion mutants prepared based on the S486A mutant show that: (a) the mutant lacking the third EGF domain (DE3) cannot form the...
- 13
- 473
- 0
Báo cáo khoa học: Dual modulation of prothrombin activation by the cyclopentapeptide plactin pptx
... resistant to the activation by Xa that formed prothrombinase To understand the mechanism for these conflicting effects of plactin D on prothrombin activation, we tested several combinations of the ... results suggested that plactin D affected Xa-catalyzed activation of prothrombin not only in the U 937 system, but also under other conditions To characterize the plactin action, prothrombin activation ... from the catalytic site, on the surfaces of the catalytic domains It is postulated that substrate recognition by prothrombinase involves a two-step mechanism with initial docking of prothrombin to...
- 13
- 704
- 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA -3 ; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG -3 (An engineered EcoRI recognition site is single-underlined The start codon ... well of the air-dried filter The radioactivity of the membrane fraction on the filter was measured with a scintillation counter (TopCount NXT; Hewlett Packard) To estimate the relative affinity of ... GAR -3 is limited Furthermore, the phenotype of gar -3 loss -of- function mutants is almost wildtype with the exception of a faster pharyngeal pumping rate [40], suggesting that the side effect of...
- 9
- 400
- 0
Báo cáo khoa học: Adenine nucleotides inhibit proliferation of the human lung adenocarcinoma cell line LXF-289 by activation of nuclear factor jB1 and mitogen-activated protein kinase pathways doc
... finding here that ATP was much more potent than UTP is not consistent with the equipotent activation of the P2Y2 receptor by ATP and UTP (reviewed in [3] ) Similarly, the inactivity of 2-MeSADP, ... of the mitotic spindle assembly checkpoint pathway that monitors the correct formation of the spindle and attachment of kinetochores [ 51, 52] There is extensive crosstalk between the ERK1 ⁄ 2activated, ... investigations The supernatant from the first centrifugation (10 00 g) was then centrifuged at 50 000 g for 45 to prepare the cytosolic fraction (resultant supernatant) The protein content was determined...
- 12
- 403
- 0
Báo cáo Y học: Activation of transcription of the human presenilin 1 gene by 12-O-tetradecanoylphorbol 13-acetate pdf
... reduced the activity of the )11 8 to +17 8 construct by about twofold; however, the mutant promoter retained twoto threefold stimulation by TPA, similar to the )11 8 to +17 8 wild type construct (Fig ... eliminated by preincubation of the control or TPA treated nuclear extracts with anti-Ets1/2 Ig, indicating that at least these complexes involve interactions with Ets1/2 Therefore TPA treatment generally ... of activation we have tested the effect of TPA on the activity of the PS1 promoter in transient infection assays in SK-N-SH cells TPA treatment activated similarly by two- to 2.5-fold the transcriptional...
- 7
- 370
- 0
Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx
... activity, with the peak of activity at 1 3 min; thus it is a fast and transient activation Such activation was not detectable in cells transfected with the empty vector, and stimulated with the ... experiment, and at the bottom is the quantification of the increase in incorporation of radioactivity detected in the GST–ATF2 fusion protein with respect to the HA epitope The results are the mean of ... demonstrate further that the stimulation of JNK activity is independent of the specific mAb used in the experiments, 29 3T cells transfected with the pCEFL-KZ-CD 53 plasmid were stimulated with another...
- 10
- 517
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008