a web based computational tool that combines the expression peaks method with gene ontology annotations
Báo cáo y học: " Transcriptional profiling of MnSOD-mediated lifespan extension in Drosophila reveals a species-general network of aging and metabolic genes" pot
... that a metareview approach using processed data was highly concordant with a meta-analysis approach based on re-analysis of the raw data the 656 genes up-regulated at the same chronological age ... template [17] MnSOD-1 was generated using primers Mn1F (5'GTCGAATAAAACGCAGATATGTTCG-3') and Mn1R (5'CCATGGTTAAATAATCGGCGTTGAA-3') MnSOD-2 was generated using primers MnSOD2F (5'-TGCAGTCGAATAAAACGCAGATATGTTCG-3') ... 7.4 and assayed immediately For the assay, a 30 μl sample (activated or non-activated) was placed in a UV transparent 96-well assay plate (Costar 3635) To start the assay, 200 μl of 37°C assay...
- 27
- 258
- 0
Báo cáo y học: "Global expression changes resulting from loss of telomeric DNA in fission yeast" pps
... 5'-CTTCAAAAACTGCTAGAGATATCGCCGG-3' and 5'-GTACTGGTAGTCCTCTGATGTATGGG-3' P3': 5'-ATGCCCCGTACGCTTATCTA-3' and 5'-TTTGCCTTTCTAGCCCATGA-3' Pdh: 5'-CAACACCAATACTGACGATGATG-3' and 5'-GCAATAGAACCAGCGGTTTG-3' Primers ... †Meiosis-associated genes with changed expression in the CESR [16] ‡This category contains genes that may also appear in other categories All other categories are nonredundant §SPAC2E1P3.04 appears ... was assessed The dye ratios measured by microarray for each strain were plotted against each other (Figure 1a) All genes had expression values that varied less than twofold between the two samples,...
- 15
- 259
- 0
Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf
... revision dates Surge capacity and capability map Hospitals should develop a planning framework (surge capacity and capability map) that presents all available and relevant internal and external resources ... organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication Meta-leaders build and maintain relationships ... of their decision-making and control They are driven by a purpose broader than that prescribed by their formal roles Therefore, they are motivated and act in ways that transcend usual organizational...
- 36
- 478
- 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ... below and that with the complementary sequence Number Gene cloning ATATATGGATCCATGTCTCTATTACTGG AAGAGATC TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG ... TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC...
- 13
- 448
- 0
báo cáo hóa học: " Immune sensitization to methylene diphenyl diisocyanate (MDI) resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses" ppt
... chemical conjugation with albumin present in the airways Given the airway localization of inflammation in isocyanate asthma patients, inhalation was originally assumed to be the primary exposure route ... speculate the possibility that reactivity with MDI may alter their normal conformation in a manner that breaks “immune tolerance” given the reported association of anti-keratin antibodies with ... G Sepharose Fast Flow was from GE Healthcare (Piscataway, NJ) Biotin-labeled rat anti-mouse IgE was from BioSource International, Inc (Camarillo, CA) Imperial protein stain and rabbit anti-mouse...
- 12
- 445
- 0
báo cáo hóa học:" Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor gene promoter" pptx
... Sunnyvale, CA) Each transfection was carried out in triplicate and experiments were carried out a total of times Data was analyzed with the paired T-test using GraphPad Prism software (GraphPad ... found that deacetylation of the Foxl2 protein by the SIRT1 deacetylase causes a decrease in Foxl2 transactivation [17] Sirt1 was also identified as a Foxl2 regulated gene that is activated by ... On the other hand, the VP16 activation domain mechanism of transactivation is the result of interactions with a variety of factors including histone acetylases, basal transcription factors, and...
- 12
- 561
- 0
báo cáo khoa học: " Global gene expression analysis of apple fruit development from the floral bud to ripe fruit" pot
... ACGAGCCTTGCACCAACCTTAATTTGAAAAGAAGTAATGCAAGTG AAGACGATAAACAACTGGTTCATCAATCAGCGGAAGAGGAACTGG CCTGGGTGGATGCTTTGACTTTGTTTGTGCCTAATAATAATACCC GACTCTGGAACCATTATATGAATGCCATCTCGGATGCTTTGCTGC ACGAATCGAGAACACGATAAGCAGGCAAGTGACATTCTCAAAGAG ... CAGTGTTGTTCCCTCCCTCAAGGCTGGGAGGAGATAAACACCAAC AAGAGTGAGCCAGCCCTTCTGGAGCAGGAGCAGGACAGAAGATAT CACGCAGTGTGACCGCTTCTCCCAGGAGGAGATCAAGAACATGTG TCAGCTCCTTTAACGCTAATATTTCCGGCAAAATCCCATGCTTGG GTGCCGGACTTACCTTTCATTGAACATGCTGCCATAACTTAGATT ... TTCCAATTCACTTCCCATCGACATCTACCAGATATCGAGTTCGTG CACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCG GCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTG GTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTC TAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGC...
- 29
- 291
- 0
LoopStar® 700 Ethernet and TDM Services Over Fiber to Multiple Customers and Locations
... per-VLAN basis, allows the carrier to carefully define how bandwidth is allocated on that shared platform In the campus or high-rise POP, a single LoopStar 700 platform can aggregate traffic ... network, the LoopStar 700 can transport Ethernet services over that infrastructure Where the backbone is a packet network, and existing Layer switches already bring Ethernet LAN traffic onto the network, ... copper and fiber Ethernet interfaces are supported, as well as T1/E1s Any combination of Ethernet and TDM bandwidth can be supported, up to the payload rate of the uplink For example, a DS3 can be...
- 4
- 350
- 0
Manifestation Manifesto: From the World Within to the World Without
... Here is an example of a general affirmation: "I now walk and move with assurance, poise, and personal power." The Power Affirmations I provide in my website are general affirmations Their purpose ... can physically show to others for their input The primary tools at this stage are a vision statement, specific affirmations (as opposed to general affirmations), and a vision board I feel that ... so that I could make an infinite number of playlists something that is a LOT easier with a digital player than with a CD Using a tireless, mechanical device (my digital player) makes using my affirmations...
- 9
- 423
- 0
Overview of Plant Biotechnology from Its Early Roots to the Present
... Rather, unique species have been found that can deal with a single or a few contaminants in a particular medium For example, plants have been found that can break down or degrade organic contaminants ... to impart an understanding of plant metabolism and how plant metabo- Industrial Agricultural Agronomic plants Pharmaceuticals Plant Biotechnology Applications Food quality Flavors and fragrances ... 4 A Kirakosyan et al and wine, the making of bread, cheese, yogurt, and other milk products, as well as the production of antibiotics, pharmaceuticals, and vaccines What has radically changed...
- 11
- 498
- 1
Tổ chức rẽ nhánh và lặp
... R NHNH PROGRAM GIAI_PTB2; VAR A, B, X: REAL; BEGIN WRITE(Nhap he so A, B, C : ); READLN (A, B,C); D:= B*B 4 *A* C; IF D > THEN Begin X1: = (-B SQRT(D))/ (2 *A) ; X1: = (-B SQRT(D))/ (2 *A) ; WRITELN(Nghiem ... LNH IF-THEN DNG Chng trỡnh PROGRAM CHAN_LE ; VAR N : WORD; BEGIN WRITE(Nhap so nguyen duong N : ); READLN(N); IF N MOD 2= THEN WRITELN (N , la so chan ) ELSE WRITELN (N , la so le ); READLN END ... CU LNH IF-THEN DNG Vớ d T N MOD 2=0 Thọng baùo: N laỡ sọỳ chụn IF N MOD = THEN WRITELN (N, la so chan) ELSE WRITELN (N, la so le ); F Thọng baùo: N laỡ sọỳ leớ Chỳ ý Trc t kh a ELSE khụng...
- 14
- 483
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... shewn that 12 of the crew have already attained to more than double that age, and unless some extraordinary fatality should befall them, it is certain that any Insurance Company which accepted the ... feel certain that the Putney race alone would not have brought on the, inflammation that ensued C was a man who had never had any rest from hard training and racing for at least two years previous ... than ordinarily trying character, for he had participated in many severe races both on the Thames and at Henley And he was a man, almost of ali men, the least likely to spare himself." Another...
- 419
- 541
- 0
Tài liệu Actions Against Abuse of the Global Financial System: Report from G7 Finance Ministers to the Heads of State and Government docx
... tools and the agencies that administer them in each of our countries that would be available to identify, trace, and seize such laundered assets, as a first step to enhancing international cooperation ... through the joint efforts of the OECD’s Committee on Fiscal Affairs (CFA) and the FATF on information exchange We look forward to further regular dialogue between the CFA and the FATF that will enable ... keeping The three initiatives together address the three key areas: inadequate anti-money laundering standards, harmful tax practices, and poor financial regulation We endorse these initiatives and...
- 8
- 485
- 0
Tài liệu There Are Billions of Dollars in Undetected Tax Refund Fraud Resulting From Identity Theft docx
... Files that also includes data from the SSA Operation Mass Mailing Database The Operation Mass Mailing database is a database of all tax returns identified as Operation Mass Mail by the Accounts Management ... 30 Individual Master File An IRS database that maintains transactions or records of individual tax accounts Individual Returns Transaction File An IRS database containing transcribed tax returns ... issued via direct deposit to either a bank account or a debit card account are made only to an account in the taxpayer’s name Management’s Response: IRS management agreed that limiting the direct...
- 40
- 322
- 0
Tài liệu Project Management Tips From web projects through to major change projects docx
... Have an agenda with times against each item and summarise after each item at the end of the meeting 37 Produce action points against each item on the agenda and circulate within 24 hours of the ... work alone, you are the senior manager! Please adapt the content to fit your situation Ron has worked in the project and change management field for many years He is passionate about project management ... communicate with them 24 Conduct Risk Assessment – carry out a full risk analysis and document it in a risk register Regularly review each risk to ensure you are managing them, rather than them managing...
- 10
- 469
- 0
Tài liệu An Aviator''''s Field Book Being the field reports of Oswald Bölcke, from August 1, 1914 to October 28, 1916 doc
... burst between them and us; probably they were afraid that there would be a general surrender on the part of their men The retreat was now general At 6:15 the main battle was over Afterward we could ... passengers, and equipped with a bomb-dropping apparatus it is a huge apparatus Outside of this, there are other battleplanes with machine guns They are a little larger than the usual run Then there are ... saw our other monoplanes arrive and was glad that they, at least, would give the Englishmen a good fight While having the damage repaired, I saw Lieutenant Immelmann make a pretty attack on an...
- 38
- 565
- 0
Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf
... of the cell That is, intermediates just made in a pathway are not part of the same pool as are identical molecules within the cell Intermediates produced within the pathway are ‘channeled’ to the ... phosphate pathway (OPPP), the urea cycle However, these investigations not provide data that can be used to calculate the fraction of the flux through a pathway that is channeled The experimental ... [14C]glucose, then B =A ¼ 1; and Fig Scheme for calculating the fraction of the total flux that is channeled (Fch) with the intermediate just made in the pathway for occupancy at the active site of the appropriate...
- 10
- 438
- 0
Tài liệu Báo cáo khoa học: "Growing Related Words from Seed via User Behaviors: A Re-ranking Based Approach" pdf
... user behaviors, semantic features and re-ranking framework together We make a reasonable assumption that if two words always co-occur in user records, then Fig Parameter λ for Candidate Generation ... P(i|j), which means that conditional probability leads to asymmetric relations The disadvantage is that each word i tends to have a close relationship with stop words that are used quite frequently ... as a relatively accurate standard for evaluation We just want to investigate whether user behaviors and re-ranking framework is helpful in the related word retrieval task under various evaluation...
- 6
- 458
- 0
Tài liệu Báo cáo khoa học: "Machine Learning for Coreference Resolution: From Local Classification to Global Ranking" ppt
... system generated the candidate partition and otherwise These features enable the learner to learn how to distinguish good and bad partitions based on the systems that generated them, and are particularly ... ranking candidate partitions by means of Joachims’ (2002) SVM package, with all the parameters set to their default values To create training data, we first generate 54 candidate partitions for each ... best partition is not computationally feasible even for a document with a moderate number of NPs, our approach explores a larger portion of the search space than the standard approach via generating...
- 8
- 518
- 1
Tài liệu Out of the Shadows African American Baseball from the Cuban Giants to Jackie Robinson ppt
... reveal much about the nature of African American baseball and its uneasy relationship with white baseball and white America Neither Giants Nor Cubans The Cuban Giants, who by the way, are neither ... realize that once a player or a fan recognized that a player could compete there was a good chance that racist feelings would abate, for, above all, both the white player and the white fan wanted ... team and the local team The attendance for the annual game was often the highest of the year [-8], (2) ✶ Parallel with serious Negro ball were the black clown teams, such as the Zulu Cannibal...
- 241
- 609
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25