a useful tool for the detection of biofilm formation an important virulence fact
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx
... et al other Listeria spp are classified to A, B, C, or D type flagella antigen; but L grayi only have the E type flagella antigen [1] According to the report by Vatanyoopaisarn et al [22], attachment ... Selection for MAb pair for a sandwich ELISA Each monoclonal antibody (MAb) was diluted in carbonate buffer (pH 9.6) to the concentration of 10 µg/ml and 100 µg of diluted MAb was added into ELISA plate ... hundred ml of each optimally diluted MAb 7A3 and IgY labeled HRP was added into each well of the plates The plates were incubated for 30 at RT and washed three times with PBS Antigen-antibody reaction...
- 6
- 388
- 0
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... Vijayarani Kumanan et al handle systems for the detection and quantification of RNA molecules [1,2,4,5] A biosensor is a lateral flow assay that provides visual or reflectance data within about ... Human Human Human Bovine Dog Negative Negative Negative Negative Negative 40 Vijayarani Kumanan et al Specificity of the assay The specificity of the lateral-flow biosensor assay was evaluated ... assess the signal-to-noise ratios with a relatively large dynamic range and the highest signal obtainable The standard lateral-flow biosensor assay was run in triplicate with μl of synthetic DNA with...
- 8
- 385
- 0
Báo cáo khoa học: "Evaluation of a blocking ELISA for the detection of antibodies against Lawsonia intracellularis in pig sera" docx
... for the serological analyses UE were responsible for the statistical analyses and drafted this part of the manuscript All the authors red and approved the manuscript Competing interests The authors ... control Sera were also prepared by the IleiTest and analysed according to the manufacturer’s instructions (Elanco Animal Health, Indianapolis, Indiana, USA) The slides were read in a fluorescence ... doi:10.1186/1751-0147-53-23 Cite this article as: Jacobson et al.: Evaluation of a blocking ELISA for the detection of antibodies against Lawsonia intracellularis in pig sera Acta Veterinaria Scandinavica 2011 53:23...
- 6
- 288
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... in the included trials and were analyzed using the same software and hardware located at the central server location in New York All MCG analyses in this database have been validated against the ... patient was already scheduled for the reference coronary angiography for any indication Coronary angiographic data was recorded digitally and on cine angiographic film and was sent back to the ... Scanlon PJ, Faxon DP, Audet AM, et al ACC/AHA guidelines for coronary angiography: executive summary and recommendations A report of the American College of Cardiology/American Heart Association...
- 13
- 684
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... ones that may and ones that cannot exhibit oscillations may be useful for the analysis of the existing models that are responsible for the oscillations Such an analysis may help to understand the ... constructed of an even number of negative paths and any number of positive paths Our approach has the advantage that it considers positive and negative interactions in a unified manner The implication of ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...
- 11
- 638
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF ... obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples were positive for the single copy ... assay had an amplification efficiency less than 100% with the M fascicularis and P cynocephalus templates which cautions against its use for accurate quantitation of the MfaRV2 and PcyRV2 rhadinoviruses...
- 12
- 509
- 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot
... CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF ... obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples were positive for the single copy ... assay had an amplification efficiency less than 100% with the M fascicularis and P cynocephalus templates which cautions against its use for accurate quantitation of the MfaRV2 and PcyRV2 rhadinoviruses...
- 12
- 471
- 0
Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot
... enables a high number of cavities on each chip and facilitates the performance of many independent assays on one plate The funnelshaped cavities avoid the appearance of meniscuses, and therefore, ... participated in their fabrication, and wrote the main parts of the manuscript GO carried out the transfection of the reporter cell line and was involved in the preparation of the manuscript AS ... tetrazolium salt WST-1 by metabolically active cells to an orange formazan dye The WST-1 assay was performed according to the manufacturer’s instructions, with appropriate controls After nanoparticle...
- 14
- 632
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
... generate estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... (called primary observation vectors) For example the secondary observation vectors may correspond to samples of data associated with another range than the range of the detected target in radar ... respectively The FAR and detection probability are computed analytically in [28] for the CONV1 receiver under the assumption of a Gaussian and circular total noise However, in situations -7- of practical...
- 45
- 467
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability ... of clinical samples and part of molecular diagnostic study LD conceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All...
- 9
- 469
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... ,seniccav dna stset citsongaid rof sdradnats fo launaM seitoozipE seD lanoitanretnI eciffO 17 -36 ,92 ,4002 seneG suriV sniarts aisAnaP rehto dna aeroK ni slamina morf sesuriv esaesid htuom-dna-toof...
- 6
- 347
- 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx
... between Fl and P2) are also heterogeneous AA or AB animals (BC1) and AB or BB animals (BC2) with proportions 1/2, 1/2 The statistical analysis of the data obtained from these populations was clearly ... and C26, and C3 and C5 The proportion of F2s to backcrosses increased between C30 and C35, C40 and C44, and C50 and C54 The major gene was characterized for each of these cases by an effect of ... preliminary analysis of available data; and iv) retrospective studies of old experiments without marker information may be important for various valuable The basis for population genetics was established...
- 11
- 368
- 0
A visualization tool for the rapid analysis of bacterial transcriptome data pot
... that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at the same time highlights additional features, such as putative regulatory sequences and ... as dataextraction and conversion algorithms, which are summarized in Table The combination of visualization and information extraction allows subsequent rounds of analyses, and thus an increase ... 95:14863-14868 Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M et al.: TM4: a free, open-source system for microarray data management and analysis...
- 6
- 510
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... collection and analysis, and with DB collected all data All authors were involved in the development of the scale and the interpretation of the results, helped draft the manuscript, and read and approved ... reliability for all categorical items, use of these items from the tool to assist clinical footwear assessment can be recommended for a range of populations Qualitative evaluation of the tool and...
- 12
- 379
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... Hôtel Dieu, Paris Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto ... by a small sample size, the limited representativeness of participants, the lack of a comparison, and the assessment of intermediate outcomes For example, we have not evaluated the impact of the ... Italy: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care Research, University of...
- 7
- 429
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... exudates (arrowheads) (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae cells and ... external biotic and abiotic factors Furthermore, at this stage, the main task of the flower bud is to complete the growth and maturation of anthers and the pistil Consequently, the intensity of the ... maximal values just after anther dehiscence (stage 4) At the latest analyzed stage (stage 5) a significant decrease of Ca2+ levels was observed in the upper parts of the pistil (stigma and style)...
- 12
- 529
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... simultaneously HCV RNA levels were expressed in IU/ml The LOD of CAP/CTM HCV assay was 15 IU/ml Data analysis Results are expressed as mean and standard deviation (SD), as appropriate The intra-assay ... intra-assay and inter-assay variations are expressed as SD and coefficient of variation (CV), based on the mean Ct values Probit analysis was performed to determine the LOD The LOD was deter- Page of ... infection Materials and methods Standards A dilution series of the World Health Organization (WHO) Second International Standard for HCV RNA (National Institute for Biological Standards and Control (NIBSC),...
- 9
- 322
- 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... template DNA preparation GPV CHV strain, a high -virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... Bio-Rad iCycler IQ detection software was used to generate the standard curve and to calculate the correlation coefficient (R2) of the standard curve and the standard deviations of the triplicate ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143 3098-3120...
- 7
- 338
- 0
Báo cáo khoa học: "Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA" ppt
... Poelstra E, Hooghiemstra M, Brandenburg AH: Clinical validation of a new real-time PCR assay for detection of enteroviruses and parechoviruses, and implications for diagnostic procedures Journal of ... (Vircell, Santa Fe Granada, Spain), was used to determine the dynamic range and within-run reproducibility of two real-time RTPCR assays with NucliSens EasyMAG Extractor, Light Cycler 480 and a different ... the obtained Ct/Cp-values and the log10 of the undiluted control (R2 = 0.984 and R2 = 0.924 for primerprobe set and respectively) The dynamic range of the assay spanned at least logs for both...
- 3
- 339
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25