a text field is created with the text tool you can resize the text field with the handle in the bottom right corner
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... for single marker analysis Statistical significance was assumed at p < 0.05 Statistical power (1-β) was calculated using binominal power calculation The power calculation for the -173 SNP and the ... analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association with poor ... polymorphism with inflammatory bowel disease in Chinese Han population Cytokine 2008, 41:44-47 Hizawa N, Yamaguchi E, Takahashi D, Nishihira J, Nishimura M: Functional polymorphisms in the promoter...
- 8
- 554
- 0
Báo cáo y học: "The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study" docx
... rs3738919 in a first sample of French Caucasian families, the same trend in replication sample 2, and again a significant association in replication sample (European Caucasian families) Finally, ... neither significant association nor linkage between SNP1 and RA in sample For SNP2, we observed a significant association for the C allele and a strong trend for a RA linkage (AFBAC, RA index cases ... disease Sample Sample (Table 1) contained the DNA from 265 European Caucasian unrelated trio families with the same characteristics as sample 1, except for a shorter mean disease duration and a different...
- 7
- 605
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC ... 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA ... fragment was generated using reverse and forward primers with the sequences 5¢-GGGAATTCCATATGGCTAAGGGGCAA TC and 5¢-AGGATCGCTGGATCCCCGTGTAAAAAA AC, respectively, with pTX367 plasmid [8], creating...
- 10
- 488
- 0
Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf
... understanding in an education context is concerned with productive and valid knowledge acquisition A process that is challenging and stimulating is crucial to creating and maintaining a community ... GARRISON, ANDERSON, AND ARCHER An awareness of the critical thinking and inquiry dynamic is an essential metacognitive ability that encourages students to approach a problem strategically and actively ... possible so that teaching presence can be established and expectations can be communicated and negotiated These are but a few obvious examples of establishing appropriate teaching presence in a higher...
- 19
- 316
- 0
Báo cáo lâm nghiệp: "A survey of forest pollution with heavy metals in the Natural Forest Region (NFR) Moravskoslezské Beskydy with particular attention to Jablunkov Pass" docx
... between the stands in the whole NFR and in the Jablunkov Pass The humus layer is less acid in beech stands, but this is not the case in the mineral soil The organic layer under beech also has a substantially ... ICP-AES as the technique of detection (Zbíral 1994) Methods of statistical analysis Exploratory statistical analysis involves the examination of mean values, coefficients of variation, maximum and ... upper-most mineral mineral mineral forest floor Horizon forest floor in comparison with the remaining area of NFR The spatial distinctness of distribution of this element in the Jablunkov Pass is confirmed...
- 9
- 379
- 0
Báo cáo lâm nghiệp: "The successional status of tropical rainforest tree species is associated with differences in leaf carbon isotope discrimination and functional traits" pot
... (height and maximal diameter of the trees) variables at the adult and sub-adult stage and a PCA analysis leading to two axes related to potential size and heliophily The three groups are fast growing ... N and SLA, and decreases with increasing C and LD (Tab II) It has been suggested that including additional traits related to water relations (e.g leaf conductance to water vapour) in these approaches ... species in the glasshouse (Tab I) For more details on data collecting protocol, see Bonal et al [7] 2.5 Statistical analyses Statistical analyses were performed using SAS programs (SASInstitute, Cary,...
- 8
- 354
- 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
... coordinated the statistical analysis YM, TY and YK performed GPI ELISA TH participated in clinical assessment TS participated in the full design and coordination of the study, and DG, SI and AT participated ... RA patients and healthy individuals P < 0.05 was considered statistically significant Results Our ELISA assay is highly specific because we used recombinant bacterial human GPI and native rabbit ... Pharmaceuticals, Osaka, Japan) was used for saturation (30 at 37°C) After two washes, sera (diluted 1/50) were added and the plates were incubated for 12 hours at 4°C After washing, alkaline phosphatase...
- 6
- 414
- 0
báo cáo khoa học: " A spindle cell carcinoma presenting with osseous metaplasia in the gingiva: a case report with immunohistochemical analysis" ppsx
... stromal metaplasia Acta Otolaryngol 2004, 124:870-873 Sugai T, Oikawa M, Uesugi N, Habano W, Jiao YF, Nakamura S, Hatakeyama S, Suhara M, Hatafuku K: Esophageal squamous cell carcinoma characterized ... formation Pathol Int 2000, 50:910-913 Kijima Y, Umekita Y, Yoshinaka H, Owaki T, Sakamoto A, Yashida H, Aikou T: A case of breast carcinoma with cartilaginous and osseous metaplasia Breast Cancer 2006, ... carcinomas, such as laryngeal cancer [20], esophageal cancer [21,22], colon cancer [23-25], lung cancer [26], and breast cancer [27] The histogenesis of the osseous and/or cartilaginous metaplasia...
- 6
- 352
- 0
Báo cáo y học: "Seropositivity is associated with insulin resistance in patients with early inflammatory polyarthritis: results from the Norfolk" pot
... polyarthritis, Rheumatoid arthritis, Insulin Resistance factor, Early inflammatory Introduction Cardiovascular disease (CVD) remains the leading cause of death in patients with inflammatory polyarthritis ... (Table 1) Factors associated with insulin resistance In an age and gender adjusted linear regression analysis, HOMA-IR was significantly associated with a number of established cardiovascular and ... TF is the previous project lead and was involved in coordinating and supervising data collection, analysis and manuscript writing SV is the project lead and has coordinated and supervised data...
- 20
- 308
- 0
Báo cáo y học: "Tumor Necrosis Factor-α +489G/A gene polymorphism is associated with chronic obstructive pulmonary disease" doc
... far In general, an association between a specific disease and an allele can be interpreted either as a causal relation or as a linkage disequilibrium between the allele and a nearby gene or a ... carina, two scans of the lower zones at cm and cm below the carina, and one at the level of the carina Scanning parameters were 1.0mm collimation, 137 kVp, 220 mA, 1.0 second scanning time, and ... statistical significance was defined as p < 0.05/k, where k is the number of parameters for the Bonferroni correction in each set of comparisons The data were analysed with the Statistical Package...
- 7
- 240
- 0
báo cáo hóa học:" Higher percentage of CD133+ cells is associated with poor prognosis in colon carcinoma patients with stage IIIB" pptx
... stage IIIB colon carcinoma patients by clinicopathological parameters with univariate and multivariate analysis Clinicopaothological characteristics N (n = 104) 5-year survival Kaplan-Meier analysis ... Monzani E, Facchetti F, Galmozzi E, Corsini E, Benetti A, Cavazzin C, Gritti A, Piccinini A, Porro D, Santinami M, Invernici G, Parati E, Alessandri G, La Porta CA: Melanoma contains CD133 and ABCG2 ... cancer nest; (B): 5% CD133+ cells in the cancer nest; (C) and (D): the staining of CD133 on the luminal surface and the basal surface of cancer cells; (E): the staining of CD133 on budding cancer...
- 8
- 550
- 0
Báo cáo khoa học: "Weak expression of cyclooxygenase-2 is associated with poorer outcome in endemic nasopharyngeal carcinoma: analysis of data rom randomized trial between radiation alone versus concurrent chemo-radiation (SQNP-01)" pdf
... Cyclooxygenase-2 expression in advanced nasopharyngeal carcinoma -a prognostic evaluation and correlation with hypoxia inducible factor-1alpha and vascular endothelial growth factor Oral Oncol 2007, ... Weak staining for COX-2 ×200 C: Moderate staining for COX-2 ×200 D: Strong staining for COX-2 ×200 patients without COX-2 analysis data (the balance of the 221 patients), there was no significant ... Hruban R, Visavanathan K, Goggins M: Tumour COX-2 expression and prognosis of patients with resectable pancreatic cancer Cancer Biol Ther 2007, 6:1569-75 Nozoe T, Ezaki T, Kabashima A, Baba H, Maehara...
- 7
- 319
- 0
Population genetic variation in gene expression is associated with phenotypic variation in Saccharomyces cerevisiae pdf
... expression data are available in the GEO database under the ID GSE1073 Each array was print-tip normalized (mean normalized as a function of spot intensity) using the SMA package of the R statistics ... the ratio of transcipts in strain i compared to the reference pool, u is the average ratio across all strains, Vi is the effect of strain i on the transcript ratio, and ei is the error An analysis ... an analysis of variance using the model yi = u + Vi + ViMj + ei where yi is the ratio of transcipts in strain i compared to the reference pool, u is the average ratio across all strains, Vi is...
- 14
- 305
- 0
Báo cáo y học: "Nucleosome rotational setting is associated with transcriptional regulation in promoters of tissue-specific human genes" pot
... Stéphane Lecrom and Alexandra Louis for technical help, Fiona Francis for critical reading of the manuscript and Yoichiro Nakatani and Shinichi Morishita for providing medaka TSS mapping data This ... probably a determinant of the energetically more favorable smooth versus kinked bending of the DNA [10]; and an arginine side-chain is located in the minor groove of all histone-DNA binding sites ... CpG islands separate transcription start sites with and without the 10-bp RR periodic signal (a, b) The 9,622 TSSs associated with a CpG island show a clear periodic signal (a) that translates into...
- 13
- 339
- 0
báo cáo khoa học: " Adiponectin receptor-1 expression is associated with good prognosis in gastric cancer" pptx
... hidetaji@staff.kanazawa-u.ac.jp HF: hfujita@mail.kanazawa-u.ac.jp IN: nino@staff.kanazawa-u.ac.jp TF: tphuji@staff.kanazawa-u.ac.jp TO: ohtat@staff.kanazawa-u.ac.jp pg Abstract Background: Adiponectin ... Mawatari H, Nozaki Y, Fujita K, Yoneda M, Inamori M, Nakajima N, Wada K, Nagashima Y, Nakagama H, Uozaki H, Fukayama M, Nakajima A Expression of adiponectin receptors, AdipoR1 and AdipoR2, in ... Kihara S, Sakai N, Nakajima T, Hasegawa K, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Hanafusa T, Matsuzawa Y Plasma concentrations of a novel, adipose-specific protein, adiponectin, in...
- 44
- 905
- 0
Báo cáo y học: "High nuclear expression of STAT3 is associated with unfavorable prognosis in diffuse large B-cell lymphoma" doc
... emerging role of signal transducers and activators of transcription in cancer Nature Clin Pract Oncol 2005, 2:315-324 29 Mantovani A, Allavena P, Sica A, Balkwill F: Cancer-related inflammation Nature ... P-STAT3, (C) weak nuclear staining of STAT3, (D) weak nuclear staining of P-STAT3, (E) strong nuclear staining of STAT3, (F) strong nuclear staining of P-STAT3 Table Relationship between the STAT3 ... OS (data not shown) as reported in other studies, which confirmed our data is reliable A forward stepwise multivariate Cox model analysis, incorporating the above factors, demonstrated that the...
- 6
- 452
- 0
báo cáo khoa học: "Autonomous growth potential of leukemia blast cells is associated with poor prognosis in human acute leukemias" ppt
... course of their disease, and inoculated into the animals both at diagnosis and at relapse However, the calculation of engraftment and growth rate was based on the initially obtained sample Out ... characteristics of the leukemic blasts Competing interests ried out research data and statistics analysis and drafted the manuscript XG participated in animal experiments AJ participated in patient ... mice and inoculated into fresh animals with a similar cell dose and method used as for the first passage To determine the dissemination of human leukemia cells into distal organs of the animals,...
- 10
- 235
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" ppsx
... Hematoxylin and Eosin (H&E) staining and mean linear intercept analysis SIRT1 deacetylase activity assay SIRT1 activity was assayed using a deacetylase colorimetric activity assay kit according ... Duquaine D, Brook RD, Aguinaldo JG, Fayad ZA, Fuster V, Lippmann M, Chen LC, Rajagopalan S: Long-term air pollution exposure and acceleration of atherosclerosis and vascular inflammation in an animal ... pentobarbital (50 mg/kg, intraperitoneally) and paralyzed with pancuronium (0.5 mg/kg, intraperitoneally) A tracheotomy was performed and an 18-guage cannula was inserted mm into an anterior nick in the...
- 10
- 371
- 0
Báo cáo y học: "Emphysema is associated with increased inflammation in lungs of atherosclerosis-prone mice by cigarette smoke: implications in comorbidities of COPD" potx
... Hematoxylin and Eosin (H&E) staining and mean linear intercept analysis SIRT1 deacetylase activity assay SIRT1 activity was assayed using a deacetylase colorimetric activity assay kit according ... Duquaine D, Brook RD, Aguinaldo JG, Fayad ZA, Fuster V, Lippmann M, Chen LC, Rajagopalan S: Long-term air pollution exposure and acceleration of atherosclerosis and vascular inflammation in an animal ... pentobarbital (50 mg/kg, intraperitoneally) and paralyzed with pancuronium (0.5 mg/kg, intraperitoneally) A tracheotomy was performed and an 18-guage cannula was inserted mm into an anterior nick in the...
- 10
- 487
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25