a study of hypnotic analgesia with hidden reports through automatic key pressing and automatic talking
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and Research 2011, 6:3 http://www.josr-online.com/content/6/1/3 ... consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, the cavus...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and Research 2011, 6:3 http://www.josr-online.com/content/6/1/3 ... consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, the cavus...
- 7
- 802
- 0
A study of stochastic network with concurrent resources occupancy
... To name a few, Cao and Zegura (1999) studied a bandwidth allocation scheme which can be viewed as a particular case of the bandwidth max-min allocation when the utility of all applications are ... max-min fair allocation if the allocation to a job cannot be increased without decreasing that of another job having a smaller or equal allocation There are many variations of the max-min allocation ... stability of the original data network can be derived accordingly Bonald and Massoulie (2001) prove the stability of of data network with (p, α)-proportionally fair bandwidth 11 allocation with such a...
- 123
- 208
- 0
A study of linguistic devices to attribute source of information in news reports english vs vietnamese
... distribution of the semantic type of reliability between English and Vietnamese As for engagement, both in English and Vietnamese, hearsay and appearance categories play a minor part as compared with ... attribution and its characteristics in syntax, semantics and pragmatics are still inaccessible to many of us 2 THEORETICAL BACKGROUND 2.2.1 Overview of Appraisal Theory The Appraisal framework is an extension ... orientation Both English and Vietnamese make more use of accuracy - orientation and lesser use of defamation Yet, the difference is not very great Vietnamese take advantage of using withdrawal of...
- 13
- 461
- 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx
... (forward, 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), SPARC (forward, 5¢-GAGACCTGTGACCT GGACAATG-3¢; reverse, 5¢-GGAAGGAGTGGATTTAG ATCACAAGA-3¢), TGFBR2 (forward, ... siRNA2, LAMP2 ⁄ siRNA1 and LAMP2 ⁄ siRNA2 are 5¢UGACUUCCCUGGCCUAUUUUU-3¢, 5¢-ACAUUGAGC UCCUCUCUUGUU-3¢, 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, ... 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; reverse, 5¢-GGACCAGGCA GTTGGCTCTA-3¢), JUN (forward, 5¢-GGATCAAGGC GGAGAGGAA-3¢; reverse, 5¢-TCCAGCCGGGCGATT-3¢), PLAU...
- 16
- 494
- 0
CASE STUDY OF COST SAVINGS WITH A NEW CHEMICAL MIXING SYSTEM AT MITSUBISHI PAPER HACHINOHE MILL PM7 potx
... C-PAM + AKD after machine screen 40sec Drainage 60sec Agitator setting High shear Medium shear Low shear A- PAM after machine screen (*) Tested at Mütec DFS retention analyzer Result of laboratory ... Chord for CPAM and AKD Ü Installation in October, 2008 Conclusion of installation in PM7 for CPAM & AKD ÜResults: PM7, additive savings after flash injection installed also for CPAM and AKD Filler ... Technologies Ltd is a Finland based corporation FiberLaboratory City of Savonlinna TrumpJet® Flash Mixing for papermaking additives 17 -Flash mixing takes place in time of two seconds -Transverse injection...
- 50
- 435
- 0
báo cáo hóa học:" Antemortem diagnosis of asbestosis by screening chest radiograph correlated with postmortem histologic features of asbestosis: a study of 273 cases" docx
... cases The Mobile, Alabama area has a large shipbuilding industry, and the majority of autopsy cases in our study were referred by a local law firm involved in legal action against these companies ... examination In many cases, the only clinical information provided was the age, sex, cause of death and presence or absence of an antemortem clinical diagnosis of asbestosis by chest radiography ... indicate an increased risk of mesothelioma and laryngeal carcinoma, but are not a precursor lesion for either [3] The results of this study indicate that a chest radiograph suggestive of asbestosis...
- 5
- 221
- 0
báo cáo khoa học: " Stigma, social reciprocity and exclusion of HIV/AIDS patients with illicit drug histories: A study of Thai nurses'''' attitudes" pdf
... Tanga EO, Nuwagaba A: Uganda: HIV and AIDS related Discrimination, Stigmatisation and Denial Geneva: UNAIDS; 2001 Ukosalul M: The signifiance of 'face' and politeness in social interaction as ... prejudicial attitudes and their actual professional behaviours to PLWHA and to people with a history of associated co-stigmatised behaviours Since the stigmatisation of PLWHA can largely be traced ... choice of a sample consisting of trainee as well as qualified nurses was partially determined by the quantitative component of the study in which qualification was treated as a co-variate for the analysis...
- 11
- 243
- 0
Báo cáo y học: "The likelihood of persistent arthritis increases with the level of anti-citrullinated peptide antibody and immunoglobulin M rheumatoid factor: a longitudinal study of 376 patients with very early undifferentiated arthritis" doc
... information about anti-CCP and IgM RF was available in 483/572 (84%) patients enrolled in the study Patients with and without available sera were similar regarding baseline characteristics and ... persistent arthritis Statistical analysis Means and standard deviations were calculated for continuous variables following a Gaussian distribution, otherwise median values and inter quartile ranges ... Serum was frozen at baseline and stored at -70°C and used to analyse anti-citrullinated protein antibodies (ACPA) (anti-CCP2, INOVA Diagnostics, Inc.® San Diego, CA, USA) and IgM rheumatoid factor...
- 9
- 259
- 0
Báo cáo khoa học: "A comparison of transcranial Doppler with near infrared spectroscopy and indocyanine green during hemorrhagic shock: a prospective experimental study" ppsx
... transcranial Doppler studies and analysed TCD data EC carried out anesthesia and instrumentation of the animals and was responsible for hemodynamic data PHT made a significant contribution to drafting ... Beer-Lambert law and absolute concentration changes are calculated by proprietary software (Hamamatsu Photonics) ICG was injected as bolus in the proximal port of the PAC at a dose of 0.1 mg·kg-1 and ... line) and at hemodynamic decompensation (orange line) Medical Systems, Natick, MA, USA) If cardiovascular variables or BIS indicated a reduced depth of anesthesia, additional propofol and sufentanil...
- 8
- 338
- 0
a study of hedging devices in conversations in gone with the wind by margaret mitchell = nghiên cứu các phương tiện rào đón trong các cuộc hội thoại của tác phẩm cuốn theo chiều gió của nhà văn margaret mitchell
... Yu‘s (2009), and pragmatic analysis, adapted from polypragmatic paradigm of hedges of Hyland‘s (1998) are utilized for the purpose of data analysis The study was performed with regards to two ... Jonesboro and Atlanta, Georgia during the American Civil War (1861 – 1865) and Reconstruction, and follows the life of Scarlett O'Hara, from the utmost luxury to absolute starvation and poverty, and ... Gone with the Wind involves at least two levels of linguistic description: a quantitative analysis and a pragmatic analysis The process of analysis is described as follows - Quantitative analysis:...
- 52
- 843
- 4
A study of correlative conjunctions as cohesive devices (with reference to the upper-secondary english textbooks)
... canals, or the English language having a nice cup of tea, or the German language racing madly along the autobahn You only find discourse.” Robert de Beaugrande (1997: 36) It is unimaginable of ... waves and orthographic forms to which we assign meaning on the basis of our past experience with them and on the basis of the situations in which these waves and forms are used Discourse analysis ... unimaginable of a world without language We get through our days exchanging various oral and written language (or, talk and text) We live by language or discourse, not in discrete audio or visual units...
- 7
- 354
- 0
A study of hedging devices in conversations in Gone with the wind by Margaret Mitchell
... Letters and Language Department, Faculty of Humanity and Culture, the State Islamic University of Malang Fraser, B (1975) Hedge performatives In P Cole & J L Morgan (Eds.), Syntax and semantics ... (1997) The concept of hedging: Origins, approaches and definitions In R Markkanen & H Schroder (Eds.), Hedging and discourse: approaches to the analysis of a pragmatic phenomenon in academic texts ... Philadelphia: John Benjamins Hyland, K., & Milton, J (1997) Qualification and certainty in L1 and L2 students' writing Journal of Second Language Writing, 6(2), 183-205 Lakoff, G (1972) Hedges: A...
- 6
- 494
- 2
TITANIUM DIOXIDE NANOMATERIALS EFFECTS ON ENDOTHELIAL CELL BARRIER INTEGRITY a CASE STUDY OF NANOMATERIALS INTERACTION WITH BIOLOGICAL SYSTEM
... predominantly deposited in the nasopharyngeal (nasal, pharyngeal and laryngeal) region In contrast, nm NPs are distributed equally in the nasopharyngeal region, tracheobronchial region and alveolar ... endothelial barrier capability to sieve macromolecules in many organs and tissues (Dejana et al., 2008; Yuan and Rigor, 201 0a) At the AJs, structural stability is maintained primarily through ... In addition, these conduits facilitate the removal of carbon dioxide and metabolic wastes from the tissues (Yuan and Rigor, 2010c) The transport toward and away from organs is facilitated by macrovasculature,...
- 164
- 378
- 0
A sociological study of tamil entrepreneurship with special reference to up country tamil business in sri lanka
... Moreover, Dr Nageshwaran, the Head of the Department of Languages of Sabaragamuwa University of Sri Lanka and Prof Chandrasekaran, Dean of the Faculty of Education of University of Colombo enhanced my ... colleagues Mr Aruna Shantha, Mr Niroshan Vithanage, Ms Shanthi Hemalatha, and Mr Sampath Fernando, Athula Samarakoon and Miss Kalpani come to mind as gracious friends in this adventure I also offer ... mostly by the British planters in tea and coffee estates of Sri Lanka‟s central highland areas such as Badulla, Nuwara Eliya, Kandy, Matale and Rathnapura According to the census of 2001, 855,888 people...
- 252
- 606
- 0
Structure and function of methyltransferases from antibiotic resistance bacteroides of human intestine and a study on nm ng with cam
... primerBT_2972: Forward: 5’CTTTCATATGCATCATCATCATCATCATAGTAACAATAATACAT’3 Reverse: 5’ CTTTCTCGAGTCATCTTTTTTGTCCTATATAGAATACGTA’3 BVU_3255: Forward: 5’ CTTTCATATGCATCATCATCATCATCATAATAATGAC ’3 Reverse: ... titrated against Ca2+/CaM; (B) R4 3A Nm titrated against 118 xiii apo CaM; (C) R3 8A Ng titrated against Ca2+/CaM; (D) R3 8A Ng titrated against apo CaM Figure 6.19: Interactions of (A) NmIQ2 and ... expression and purification profile of BT_2972 (A) and BVU_3255 (B) Lane 1- marker, lane 2- cleared lysate, lane 3- flow through after affinity binding, lane and 5- washes of Ni-NTA beads, lane and...
- 155
- 408
- 0
A numerical study of wave interaction with porous media
... experimental results (Run No of Savage, 1953) and theoretical results (Liu and Dalrymple, 1984; Gu and Wang, 1991) 122 Fig 5.9 Variation of wave damping rates with wave nonlinearity for waves with ... boundary layer adjacent to a porous seabed (Mendoza and Zhou, 1992; Conley and Inman, 1994) and hydrodynamic behavior of sediment particles (Neilson et al., 2001) Wave damping is the decay of wave ... primary features of breakwaters The most common existing breakwaters are permeable that are made of quarry stones or artificial blocks Permeable breakwaters have several advantages over impermeable...
- 244
- 396
- 0
A study of modelling and monitoring time between events with control charts
... exponential data natural log x LIST OF TABLES Table 5.3 The ARLs of X-MR chart and EWMA charts with transformed exponential data (TE EWMA) Table 5.4 The ARLs of CQC chart and EWMA charts with transformed ... exponential data (TE EWMA) Table 5.5 The ARLs of EWMA charts with transformed exponential data and exponential EWMA chart Table 5.6 In-control ARLs of EWMA charts with transformed Weibull data Table ... values for the design of CUSUM chart with transformed exponential data Table 4.3 ARL values of X-MR chart and CUSUM chart with transformed exponential data Table 4.4 ARL values of CQC chart and...
- 243
- 652
- 0
A study of bloating symptomatology, the role of gastrointestinal transit and the response to treatment with the 5 HT4 receptor agonist in patients with bloating predominant irritable bowel syndrome
... that IBS patients with bloating have impaired intestinal handling of gas loads (Caldarella et al, 2002; Serra et al, 2001) Gas transit is tuned by a series of reflexes acting at various sites of ... associated with tegaserod are diarrhea and headache In summary, tegaserod is a potent 5-HT4 receptor partial agonist which has shown efficacy in the treatment of abdominal pain and constipation ... broad IBS has historically been viewed as a diagnosis of symptom-based rather than as a primary diagnosis However, for a variety of reasons, the diagnosis of IBS is not an easy task compared with...
- 144
- 356
- 0
A STUDY OF DYE SENSITIZED SOLAR CELLS WITH IN SITU POLYMERIZED POLY (3,4 ETHYLENEDIOXYTHIOPHENE) AS HOLE TRANSPORTING MATERIAL
... years is anticipated to grow at an average rate of 2% each year.[3] However, with the increased energy consumption, the reserves of fossil fuels are decreasing year after year Another problem accompanying ... space for the improvement of DSSCs In addition, the materials utilized in DSSCs, such as TiO2 film and sensitizer, are all readily available DSSCs have some other advantages, such as easy to fabricate, ... research due to its abundance, cleanliness, easy accessibility, silence and little need for maintenance Figure 1.2 Capacity of solar energy compared with some other renewable energies and global...
- 101
- 578
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu