a strategy for rapid identification of novel therapeutic leads from natural products
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx
... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated in the coordination of the...
- 9
- 750
- 0
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... times and the long distances Thanks for always being there for me and for being my number #1 fan v ABSTRACT Aditi Ajit Bapat INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION ... options available to treat cancers Many chemotherapeutic drugs act by damaging DNA, which leads to an accumulation of damage resulting in impaired cell signaling and ultimately causing cell death ... Normal cells are proficient in all forms of DNA repair; however, deficiency of a particular DNA repair pathway in cancer cells can lead to elevated levels of other DNA repair pathway proteins leading...
- 156
- 218
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... the variation in ST was large, and hence approximately half of the subjects terminated the tests before 50% of the maximum time had passed Outcome data were analysed using a slope calculated as ... submission TF Participated in the design and preparations of the study TF also participated in the analysis and drafting of the manuscript All authors have read and approved the manuscript Acknowledgements ... experimental trials, were responsible for the statistical analysis and participated in the drafting of the manuscript TL participated in the drafting of the study and the final preparations before...
- 9
- 609
- 0
Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx
... screening A value of above 3.0 is regarded as satisfactory for screening (for example in plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, ... content of 6% The meal was mixed and then 15 g was removed with a spatula for disk samples and about g for extreme value samples and placed in a sample cup After the samples had been scanned under a ... available and the number of samples used in the calibration and validation sets for all criteria The descriptive statistics for criteria analysed in the laboratory for these powder samples are...
- 12
- 316
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency...
- 9
- 634
- 0
Novel technique for rapid detection of a-globin gene mutations and deletions pot
... peaks — — peaks — peak peaks peak — aa/aa CS/aa QS/aa WS/aa of mutation carrier samples, as follows: cases of aCSa/ aa, cases of aQSa/aa, and cases of aWSa/aa (Table I) These results were in accordance ... for the duplex PCR products of DNA samples of known genotypes at 50 C SEA/ SEA; SEA/aa; -SEA/aCSa; aa/aa; 5 23.7/aa; 24.2/aa; aQSaa/ aa The peak appeared at 5.1 0.1 min, which indicates aa, ... 2a3 .7/aa 2a4 .2/aa 2a3 .7/ -a4 .2 2a3 .7/- 2a4 .2/- 2a3 .7/ -a3 .7 2a4 .2/ -a4 .2 /-aa/aa (including CS/aa cases, QS/aa cases, and WS/aa cases) the original genotype The method has predictive values and is...
- 8
- 557
- 0
Báo cáo y học: "Identification of novel genetic susceptibility loci for Behçet''''s disease using a genome-wide association study" pps
... Behcet's disease Hum Immunol 2007, 68:201-205 Baranathan V, Stanford MR, Vaughan RW, Kondeatis E, Graham E, Fortune F, Madanat W, Kanawati C, Ghabra M, Murray PI, Wal- Available online http://arthritis-research.com/content/11/3/R66 ... The authors declare that they have no competing interests YF performed the acquisition of data RW performed the acquisition and analysis of data BLC performed the analysis of pooling data HD and ... provided DNA samples, made a substantial contribution to the acquisition of data, and critically revised the manuscript AHS designed the experiments, performed data analysis and interpretation, and...
- 7
- 381
- 0
A novel multiplex suspension array for rapid subgenogrouping of enterovirus 71 (EV71) strains from the 2008 epidemic of hand
... CA – California, USA; CT – Connecticut, USA; IA – Indiana, USA; MAA – Peninsular Malaysia; OR – Oregon, USA; SAR – Sarawak, Malaysia; SIN – Singapore; TW – Taiwan; TX – Texas, USA The VP1 nucleotide ... Singapore General Hospital for providing strain 3437/Sin/06 and Dr MJ Cardosa from University of Sarawak for providing strain MY104-9-SAR-97 and S10862-SAR-98 I am also grateful to the NUS Academic ... 71 can also cause herpangina Herpangina is a mild illness characterized by onset of fever and sore throat, associated with the development of raised papular lesions on the mucosa of the anterior...
- 228
- 454
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... (suspended biomass) to form aerobic granular sludge for all the experiments was obtained from an aerobic basin of a municipal wastewater treatment plant (Tokyo, Japan) Table - Wastewater composition ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8...
- 8
- 481
- 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated immunoassay ... Mahal LK (2007) A ratiometric lectin microarray approach to analysis of the dynamic mammalian glycome Proc Natl Acad Sci USA 104, 11534–11539 14 Tateno H, Uchiyama N, Kuno A, Togayachi A, Sato ... Ito H, Sato T, Shikanai T, Takahashi Y, Takahashi K & Narimatsu H (2005) A strategy for identification of oligosaccharide structures using observational multistage mass spectral library Anal Chem...
- 11
- 854
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic activity YN-1, K562, HeLa...
- 12
- 621
- 0
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
... International Conference on Computational Linguistics, pp.218-224 COLING-ACL’98 Lance A Ramshaw and Michael P Marcus ( In Press) Text chunking using transformation-based learning In Natural Language ... first and the third parameters are trigrams of T and B respectively The second and the fourth are lexical generation probabilities Probabilities (1) and (2) can be calculated from POS tagged data ... globally and assigned a score to each possible baseNP structures However, they did not consider any lexical information This paper presents a novel statistical approach to baseNP identification, ...
- 8
- 482
- 0
Dự án nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed (Milestone 7) " potx
... entry, cleaning and preliminary analysis of the survey data from livestock producers; • completing compilation and analysis of available secondary data; • documentation of activities for the training ... Agriculture and Rural Development Vietnamese Project Team Leader Dr Nguyen Do Anh Tuan Australian Organisation University of Western Australia Australian Personnel Ms Sally Marsh, Dr Donna Brennan, Professor ... in data cleaning using STATA In October, Dr Brennan and Ms Marsh designed templates for the CAP team to provide guidance and direction for the preliminary analysis of the data Dr Brennan and...
- 12
- 529
- 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx
... Institute of Policy and Strategy for Agriculture and Rural Development Vietnamese Project Team Leader Dr Nguyen Do Anh Tuan Australian Organisation University of Western Australia Australian Personnel ... spmarsh@cyllene.uwa.edu.au In Australia: Administrative contact Ms Jan Taylor Name: School Manager Position: Organisation Agricultural and Resource Economics, University of Western Australia In ... Build capacity at IPSARD in research of value chain, industrial organisation and production economics Staff at IPSARD/CAP will be the primary beneficiaries of this Objective Increased capacity at...
- 19
- 497
- 1
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Milestone 4 " ppt
... with farmers as the agents pay the company directly • Large companies say that small companies can’t compete: they have no capital, can’t buy raw materials to store for months, have no advanced ... competitiveness: management of quality and technology, after sale service and material purchasing strategy • The high level of material inputs that are imported raise animal feed production costs Should material ... concentrate and sell to remote locations Is there a niche market for SMEs? Need to look at comparative advantage in the whole value chains (e.g for large and smaller mills) and consider social and...
- 5
- 533
- 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Use of Industrial and Mixed Feed by Livestock Producers in Vietnam " doc
... Departments of Livestock Production and Animal Health, Ministry of Agriculture and Rural Development and provincial Departments, relevant staff of the National Institutes of Animal Husbandry and ... Department of Animal Health, • Department of Cooperatives and Rural Development, and • National Agro-Forestry-Fishery Quality Assurance Department Adoption of Policy Facilitating the adoption of policy ... potentially have valuable input into policy for that sector The Thai Feed Mill Association was also mentioned as an enterprise association that had policy input in Thailand A further idea was that...
- 27
- 536
- 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " MS10 potx
... Institute of Policy and Strategy Agriculture and Rural Development Vietnamese Project Team Leader Dr Nguyen Do Anh Tuan Australian Organisation University of Western Australia Australian Personnel ... and market analysis, including value chain analysis, production economics, and industrial organisation • Training on data management techniques including: data entry in Microsoft Access, data ... was completed, imports of raw materials for livestock feed have dramatically increased in Vietnam Problems associated with the procurement of raw materials were clearly a major concern of participants...
- 14
- 478
- 0
Báo cáo khoa học nông nghiệp " CARD Project 030/06 VIE: Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pptx
... Departments of Livestock Production and Animal Health, Ministry of Agriculture and Rural Development and provincial Departments, relevant staff of the National Institutes of Animal Husbandry and ... Department of Animal Health, • Department of Cooperatives and Rural Development, and • National Agro-Forestry-Fishery Quality Assurance Department Adoption of Policy Facilitating the adoption of policy ... potentially have valuable input into policy for that sector The Thai Feed Mill Association was also mentioned as an enterprise association that had policy input in Thailand A further idea was that...
- 27
- 547
- 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pdf
... meal, molasses from the local area (and even rejects from pet feed) For example, the Mualek Dairy Cooperative sources all raw materials locally (except for some soybean meal from Argentina) – and ... small- and medium-scale companies 13 • Thailand, Malaysia and Indonesia have adopted the Japanese SME model with variations to suit each nation's cultural and social environment In Thailand for ... Vietnam Vietnam has many ducks – but Avian Influenza is an issue However, ducks require low capital so this is an advantage Vietnam is buying cattle and livestock materials from Laos and Cambodia...
- 14
- 583
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25