a stochastic programming tool to analyze the large scale integration of wind energy
báo cáo hóa học:" Using individual growth model to analyze the change in quality of life from adolescence to adulthood" potx
... study and quality of life data collection Henian Chen analyzed the data, interpreted the findings, and drafted the article Patricia Cohen supervised the data analysis and assisted with the interpretation ... trajectories of individuals across time or age as the basic unit of analysis Trajectory aspects include mean over time or age: is an individual's average QOL score higher or lower than that of ... Linear, quadratic, cubic or other models can be fit, as a function of age or time Setting up the data file Virtually all programs that analyze growth or time-changing variables of individuals...
- 7
- 352
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... before FACS analysis to exclude dead cells and enumerate mDC viability The samples were run on a FACScalibur or FACScanto flow cytometer and analyzed using FlowJo 7.2.2 software (Tree Star Inc., Ashland, ... Pittsburgh Protocol maturation (Fig 2) The viability of the harvested mature DC from the roller bottles and static flasks was also assessed using 7-AAD staining of the cells prior to FACS analysis In ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment...
- 11
- 469
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
... professional/paraprofessional, and a CBT (Cognitive Behaviour Therapy) rather than educational model [10] Self-management approaches can increase dissemination of evidence based interventions to large ... the relative is in They are given the trial allocation by telephone RA2 contacts the relative by telephone and post to inform them which arm of the trial they have been allocated to RA2 contacts ... format of the toolkit and type and amount of support required to use it Barriers and facilitators to using the toolkit and support will be identified from the perspective of the relatives, but also...
- 7
- 305
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... in a treatment questionnaire (see below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence ... between the PSW and the participant will take place on-site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant ... Ruggeri M, Dall'Agnola R: The development and use of the Verona Expectations for Care Scale (VECS) and the Verona Service Satisfaction Scale (VSSS) for measuring expectations and satisfaction with...
- 7
- 443
- 0
Báo cáo y học: "Using an agent-based model to analyze the dynamic communication network of the immune response" docx
... file 3) The adjustable parameters and their initial values are provided in additional file The agents and spaces are extensions of Java classes in the RepastJ software library The behavioral rules ... diagrams for of all of the agents contain the details of their behavioral rules with literature citations, representing them as finite state automata Agent behaviors are listed, categorized, and ... Additional file 4: A list of all parameters Initial parameter values A list of all of the parameters in the simulation, most of which are accessible from the GUI Additional file 5: Key to state diagrams...
- 25
- 263
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ... their living; they need to maintain their families. Also because of the relative large initial investment costs they are in debt and have to repay the banks in short terms. The ... negative impacts, especially in the future, when the province has the plan to develop the aquaculture to be the key sector of local economics [6]. A re a (h e c ta r s ) January and ...
- 13
- 487
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... coordination All authors contributed to the interpretation of data and writing of the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they...
- 8
- 492
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 412
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
... position The CA-6000 linkage measures head position relative to the base affixed at the first thoracic vertebra Matching Lucite blocks, one attached to the headband of the CA-6000, and the other attached ... Mathsoft Inc, Cambridge, MA) Variables of primary interest were the average head orientation at the target position for seconds before deconditioning and the average head orientation at the target ... the projection of the laser light on a large screen located 6' in front of the participant The inclination of the headpiece with respect to vertical was recorded and MVC was determined separately...
- 7
- 211
- 0
Tài liệu MATLAB® 7 Programming: How to Contact The MathWorks docx
... Diagonal Matrix Use diag to create a diagonal matrix from a vector You can place the vector along the main diagonal of the matrix, or on a diagonal that is above or below the main one, as shown ... matrix, also allowing for accumulation diag Create a diagonal matrix from a vector magic Create a square matrix with rows, columns, and diagonals that add up to the same number rand Create a matrix ... Concatenating Matrices MATLAB is a matrix-based computing environment All of the data that you enter into MATLAB is stored in the form of a matrix or a multidimensional array Even a single numeric value...
- 865
- 577
- 0
A study on techniques to improve the 1st year english majors' speaking skill at HPU
... (http://www.researchgate.net) Approaches to the teaching of speaking 4.1 The Grammar- translation Method In the Grammar- translation method, students are taught to analyze grammar and to translate from ... performers a chance to participate and monitoring their performance to see that it is satisfactory 5.3 The role of the teacher at the production stage At the final stage, the production one, the teacher ... people have a hard time understanding each other, and thus many people strive to change their accent There is a fact that people hardly can get rid of their accent They just can actually change their...
- 70
- 1,505
- 12
A logic-programming approach to network security analysis potx
... that assumes various vulnerability situations, and the generation of attack trees The major advantage of the logic -programming approach is its clear specification of reasoning logic and the separation ... represented as Datalog facts, and the deductive engine is implemented as a Datalog program that runs on the inputs from the database The Datalog facts representing the original database are called the ... that an attacker can read webPages, it is also safe because the data is supposed to be publicly available anyway In the wake of new vulnerabilities, assessment of their security impact on the...
- 130
- 404
- 0
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot
... molecule (A) according to Eqn (2): A NC 2ị where N is Avogadros number (Table 1) The ability of AP1 to spread on an aqueous surface and to form a stable monolayer was investigated The barriers of the ... Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a Gauss fraction of 0.550.6 The curfit ... plot analysis of AP1 (m), the known anionic a- AMP, maximin H5 (d), and peptides of the a- AMP dataset (http://www.uclan.ac.uk/biology/bru/amp_data.htm), all as described in the text AP1, maximin...
- 12
- 688
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... quantitation, and spectral characterization In order to study the kinetics of NADP+ oxidation to NADPO catalyzed by FprA, an NADPO assay method was required After testing different analytical chromatographic ... basis of the phosphate released by alkaline phosphatase treatment The absorbance spectrum of the nucleotide is shown in Fig 3A in comparison to those of NADP+ and NADPH A peculiar feature of the...
- 10
- 406
- 0
báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx
... Garc a- Campayo J, Pascual A, Alda M, Marzo J, Magallón R, Fortes S: The Spanish version of the fibrofatigue scales: validation of a questionnaire for the observer’s assessment of fibromyalgia ... relation to other variables obtained by hetero-assessment Calculation was made of the score obtained by each patient in relation to each of the factors obtained To this effect, the factorial ... rules, along with a reliability study of the corresponding scales and, where applicable, an exploration of the scales obtained in our sample, based on exploratory factor analysis The aim was to simplify...
- 7
- 460
- 0
cáo khoa học: " A knowledge translation collaborative to improve the use of therapeutic hypothermia in post-cardiac arrest patients: protocol for a stepped wedge randomized trial" pdf
... Michael’s Hospital, Past Chair of the Advance Cardiac Life Support Committee of the American Heart Association and the Co Chair of the Advance Life Support Task Force of the International Liaison Committee ... reporting of laboratory CPR research A statement for healthcare professionals from a Task Force of the American Heart Association, the American College of Emergency Physicians, the American College of ... are transferred to a participating hospital following an OHCA Trained in-hospital data collectors will complete chart abstraction of the variables related to post-arrest care for each of the hospitals...
- 7
- 435
- 0
cáo khoa học: " Developing a theory-based instrument to assess the impact of continuing professional development activities on clinical practice: a study protocol" doc
... with to a maximum of 10 items A minimum of 100 data entries are needed for an exploratory factor analysis (EFA) [19] Also, a minimum of 10 data entries are needed per parameter to make estimations ... 23 24 Federation of Medical Regulatory authorities of Canada: Position statement 2008 of the Federation of Medical Regulatory Authorities of Canada Graham ID, Logan J, Harrison MB, Straus SE, Tetroe ... of Shared Decision Making in Primary Healthcare GG is Canada Research Chair in Health Behaviours and Canada Research Chair in Knowledge Transfer and Uptake JG is director of Knowledge Translation...
- 6
- 501
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25