a reporter assay to detect transfer and targeting of mirnas in stem cell breast cancer co cultures
báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx
... contamination of SMC cultures was observed, assessed considering the binding and internalization of DiI-labeled Ac-LDL Average time to reach passage cell density and percentage of viable cells values ... obtaining the four vascular cell types from each individual UC to determine their cellular and molecular properties, as both ECs and SMCs are important in maintaining the vascular tone We have ... uncomplicated pregnancies, at term (gestational age ≥ 37 weeks), ascertained according to the method of Ballard et al [17] and normal delivery or Caesarian section in the absence of perinatal...
- 10
- 431
- 0
Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt
... ecruos a sa doolb droc lacilibmu namuH H akoareT ,T uzimusaY ,K esakaT ,C otaS ,S iirA ,K otomareT ,Y araH ,K otiaS-uzimihS ,M ebanataW ,R ieznihC ,Y akanaT ,S amunikaK 31 213-592 ,46 ,7991 mehcoiB ... ASU icS dacA ltaN corP sllec lamorts devired-worram enob yb deraperp tnemnorivneorcim elbatius a rednu stsalcoetso otni gnitaitnereffid fo elbapac era segahporcam dna setyconom erutam :stsalcoetso ... :stsalcoetso fo nigirO T aduS ,JT nitraM ,T agoK ,T arahihsiN ,T ikasaS ,H akanaT ,T ustakA ,N ihsahakaT ,N awagadU 52 373-763 ,691 ,1991 deM loiB pxE coS corP worram eht ot sllec rotinegorp citeiopomeh...
- 6
- 410
- 0
Báo cáo y học: " Intratracheal transplantation of human umbilical cord blood-derived mesenchymal stem cells attenuates " pps
... with an intraperitoneal injection of a mixture of ketamine and xylazine (45 mg/kg and mg/kg, respectively) Briefly, each mouse was restrained at a 70° angle against a plastic wall, an otoscope was ... intratracheally For intratracheal transplantation, the animals were anesthetized and the catheter was placed as described above After intratracheal transplantation, the catheter was removed and ... post-injury day and attenuated lung inflammation, including a reduction in MPO activity and inflammatory cytokine protein levels, at postinjury days and MSC transplantation also reduced the elevated...
- 11
- 353
- 0
Báo cáo khoa học: "Transplantation of canine umbilical cord blood-derived mesenchymal stem cells in experimentally induced spinal cord injured dogs" pot
... desserpxe saw ataD :sisylana lacitsitatS droc lanips degamad eht fo retnecipe eht ta demrofrep erew sesylana owt esehT erawtfos emas eht gnisu dezylana saw aera detanileym ehT )ASU ,htlaeH fo setutitsnI ... stceffe cinegoigna ehT ]81[ aimehcsi SNC lacof retfa stniop hcnarb ralucsav dna aera ecafrus ralucsav ,noitarefilorp lailehtodne fo sesaercni yb sisenegoigna secnahne FSCG ehT ]21[ rotcaf htworg lailehtodne ... ;eniportA( etaflus eniporta htiw gk/gm ta )aeroK ,mrahP aN aH ;lopenA( lofoporp dna gk/gm 3.0 fo esod a ta )aeroK ,mrahP ahW gnoD ;edoleM( mapezaid fo noitartsinimda suonevartni htiw dezitehtsena erew...
- 8
- 226
- 0
Báo cáo khoa học: "Implantation of canine umbilical cord blood-derived mesenchymal stem cells mixed with beta-tricalcium phosphate enhances osteogenesis in bone defect model dogs" ppsx
... Kitaura H, Nagata N, Fujimura Y, Hotokezaka H, Yoshida N, Nakayama K Effect of IL-12 on TNF-alphamediated osteoclast formation in bone marrow cells: apoptosis mediated by Fas/Fas ligand interaction ... using an attached digital camera and a NIS-Elements system (Nikon, Japan) The areas of new bone formation and the residual β-TCP were determined and converted to a percentage of total area of bone ... 8.75 NBA: new bone formation area RTA: residual β-TCP area TA: total a area *p ＜ 0.05 compared with C group All values are means ± SD Fig Lateral radiographs of antebrachium at 0, 4, 8, and 12...
- 7
- 220
- 0
Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps
... acid-2-phophate for 30 days Osteogenic differentiation was evaluated by calcium mineralization Alizarin red S staining was used to determine the presence of calcium mineralization For Alizarin red S staining, ... AACAATACCTC-3´; antisense, 5´-AAGGGTAGGACGCTCCGTAT-3´), collagen 1A1 (COL 1A1 ) (sense, 5´-CACCTCAGGAGAAGGCTC AC-3´; antisense, 5´-ATGTTCTCGATCTGCTGGCT-3´), osteonectin (SPARC) (sense, 5´-TGAGAAGGTATGCAG CAACG; ... differentiation as shown in pellet formation and toluidine blue staining In this study, we used cUCB-MSCs at 3∼5 passage Generally, increasing the passage number of adult stem cells often leads to a...
- 7
- 439
- 0
Báo cáo y học: "Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-culture with human disc cells stimulate proteoglycan and collagen type I rich extracellular matrix" ppsx
... production using the DMB assay [26] Scoring of immunohistochemistry and toluidine blue staining Scoring of slides from immunohistochemical staining of cellsurface markers, ECM proteins and toluidine blue ... and assays HT and RD retrieved tissues from animals JAI performed and modified all immunohistochemical assays HT and HEG supervised statistical analysis All authors read and approved the final ... ([HBSS] Gibco, Carlsbad, CA) and rapidly transported to the laboratory Approximately g of fat tissue was obtained per harvest and processed as described below AD-MSC isolation and plating Cell culture...
- 10
- 446
- 0
Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx
... 5’-CCAAGTAAGTCCAACGAAAG-3’ and 5’-GGTGATGTCCTCGTCTGTA-3’; PPARg-2 specific primers, 5’-CATTCTGGCCCACCAACTT-3’ and 5’CCTTGCATCCTTCACAAGCA-3’; b-actin specific primers, 5’-CATGTACGTTGCTATCCAGGC-3’ and ... an initial lag phase of days, a log phase at exponential rate from to days, and a plateau phase According to the Patterson formula, the doubling time in the log phase of the 3rd passage was 24.8 ... immunocytochemical assays XJS was in charge of flow cytometric analysis ZYD took part in differentiation assays YJX by part initiated the study YL and XH participated in manuscript modification XH and...
- 9
- 519
- 0
Báo cáo y học: "HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells" pot
... assayed with ELISA TransAM assay the PPARg activity at day in the same experimental conditions HIV-1IIIb, HIV-1ada and recombinant gp120 induced (Figure 6A) a significant up-regulation of PPARg ... were analyzed using the CXP Software (Beckman-Coulter) PPARg activity assay PPARg transcription factor activity was detected by TransAM PPARg kit (Active Motif, Carlsbad, CA, USA) as indicated ... transduction intracellular pathways [63] In particular the interaction between gp120 and CD4 determines apoptosis activation in several cell lineages such as CD34+ hematopoietic progenitor cells and CD4+...
- 18
- 247
- 0
Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx
... embedding in paraffin and the tissue was sectioned at μm for light microscopic analysis After hematoxylin and eosin (H & E) staining, the number of alveolar sacs was determined in a blinded fashion ... study, data acquisition and analysis as well as drafting the manuscript LTC, YHK, and YCL were responsible for the laboratory assay and troubleshooting SC, THT, MF, and SFK participated in data acquisition, ... Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of human adipose tissue mesenchymal stem...
- 13
- 280
- 0
Augmentation of neovascularization in murine hindlimb ischemia by combined therapy with simvastatin and bone marrow-derived mesenchymal stem cells transplantation pptx
... Effects of rosuvastatin and pitavastatin on ischemia-induced myocardial stunning in dogs J Pharmacol Sci 2008, 106:593-599 Matsumura M, Fukuda N, Kobayashi N, Umezawa H, Takasaka A, Matsumoto T, Yao ... (Nanjing, China) All animal experimental protocols were approved by the Animal Care and Use Committee of Nanjing Medical University and were in compliance with Guidelines for the Care and Use of ... staining against vWF (green labeling) (Fig 4) Histological and quantitative analyses showed that the number of incorporated MSCs was significantly greater in the combination group relative to...
- 10
- 230
- 0
Differentiation of bone marrow derived mesenchymal stem cells (BM MSCs) using engineered nanofiber substrates
... PLLA and PLLA/Col nanofibers are n-HA with same pattern as natural HA in human tooth Fig 3.3: FTIR spectra of (a) PLLA nanofibers; (b) mineralized PLLA nanofibers and (c) mineralized PLLA/Col nanofibers ... Utilizing electrospinning technique to fabricate PLLA and blended PLLA and Type I collagen (PLLA/Col) and employing a biomimetic approach of (2) The mineralization on incorporation of the NFS to achieve ... understanding in modulating stem cell fate and behavior, translating into potential clinical applications for regenerative medicine Such nanostructured materials mimic the subtleties of extracellular...
- 241
- 446
- 0
Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx
... and therapists using BBS, a validated functional scale that measures the ability to walk, balance while standing and other activities of daily living for ataxia patients [21] The average duration ... interpreted data and helped to draft the manuscript XH conceived of the study, participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript ... duration at the time of treatment was 26 years Patients treated came from Australia, Britain, Canada, China, Chile, Italy, South Africa and U.S .A There were no significant demographic or baseline...
- 5
- 324
- 0
báo cáo hóa học:" Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia" pdf
... and therapists using BBS, a validated functional scale that measures the ability to walk, balance while standing and other activities of daily living for ataxia patients [21] The average duration ... interpreted data and helped to draft the manuscript XH conceived of the study, participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript ... duration at the time of treatment was 26 years Patients treated came from Australia, Britain, Canada, China, Chile, Italy, South Africa and U.S .A There were no significant demographic or baseline...
- 5
- 472
- 0
Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf
... primary antibody (Ab) (either mouse anti -a- actinin (sarcomeric) at a dilution of 1:200, or mouse anti-myosin cardiac heavy chain a/ b at a dilution of 1:4 (Millipore, Billerica, MA, USA) in PBS-1% ... spin coating using a single wafer spin processor (Laurell Technologies, North Wales) at 3000 rpm and the spin coating time of 20 s The coated films were dried in air for at least 30 and then annealed ... the cell nuclei and cytoplasm show Zhao et al Journal of Biomedical Science 2011, 18:37 http://www.jbiomedsci.com/content/18/1/37 Page of Figure Immunostaining of anti -a- actinin and anti -a MHC in...
- 9
- 262
- 0
Báo cáo y học: "Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis" pps
... erosion of cartilage and subchondral bone, and = loss of joint integrity and ankylosis Each joint was scored separately by two individuals unaware of the treatment protocol To trace the migration of ... that administration of UC-MSCs attenuated systemic inflammation in CIA in mice UC-MSCs downregulated the production of the proinflammatory cytokines TNF -a, and IL-6 in vitro and in vivo In addition, ... decalcified and paraffinembedded using standard histologic techniques Serial μm sections were cut and stained with hematoxylin and eosin to examine morphologic features and assess the histologic...
- 13
- 297
- 0
Immunological characterization of human umbilical cord lining derived cells and their therapeutic application in a diabetic mouse model
... epithelial cell AF amniotic fluid AFSC amniotic fluid stem cell AHU animal holding unit AMC amniotic mesenchymal cell APC allophycocyanin balb bagg albino BLAST basic local alignment search tool ... understanding of the underlying mechanisms and the characterization of definitive MSC markers 2.4 Fetal/neonatal stem cells 2.4.1 Background Fetal and neonatal stem cells come in between embryonic and ... suppression of Stat5 phosphorylation in T cells with a consequent reduction in T cell proliferation (Sato et al 2007) Another candidate molecule was prostaglandin E2, as inhibitors of prostaglandin synthase...
- 226
- 362
- 0
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... posttranslational modification involving removal of an N-terminal signal peptide and C-terminal residues in the polypeptide chain and attachment of a glycosylphosphatidylinositol group for cytoplasmic membrane ... N-terminal binding antibodies SAF34, P4 and 8G8 or the C-terminal binding antibodies 6H4, SAF60, SAF70 and SAF84 in consideration of species recognition Values are calculated for the N-terminal antibodies ... serial dilutions of samples (Fig 2) Linearity consisting of continuous signal increase and of reproducible glycoprotein patterns was determined in the range between and 10 lL of brain homogenate...
- 11
- 536
- 0
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf
... CTCCTTAATGTCACGCACGAT ASAT-D 22 TCTTTGTGATGTGTGCATTCAA ASAT-R 20 TATTCCCGTTTCCAACGAAG ALU-D 20 ACGAGGTCAGGAGATCGAGA ALU-R 19 GATCTCGGCTCACTGCAAG S3T-D 19 AATCAACCCGAGTGCAATC S3T-R 22 TCCATTCCATTCCTGTACTCGG ... strand) and CTAGAAAAAGAGAA CCTCTTGAGACGTCATCGACGTCTCAAGAGGTTCT (bottom strand) Targeted segments are present in all splicing variants of PRDX5 mRNA and therefore should silence all these variants ... For the control plasmid, we used hairpin oligonucleotides targeting GFP (sequences underlined) gene: TTTGAAGAAGTCGTGCTGCTTCATGGA AGCAGCACGACTTCTTCTTTTT (top strand) and CTA GAAAAAGAAGAAGTCGTGCTGCTTCCATAAGCAG...
- 11
- 463
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25