a rationale for treatment by manual therapy
Báo cáo y học: "Possible adverse events in children treated by manual therapy: a review" pptx
... that minor or moderate adverse events after manual therapy are common but that serious adverse events are rare Manual therapy such as spinal manipulation in adults appears to have significantly ... by other authors, approximately half of adult patients treated by manual therapy are likely to experience a minor to moderate adverse event after treatment, and particularly after the first treatment ... with pediatric manual therapy Unfortunately very few high quality studies are currently available in this area Most evidence comes from studies on adult patients and spinal manipulative therapy From...
- 7
- 323
- 0
Social factors as a basis for treatment
... International Congress on Treatments in Psychiatry: An Update, Florence, Italy.) Gegenava, M and Kavtaradze, G (2006) Risk factors for coronary heart disease in patients with schizophrenia Georgian ... schizophrenia in an urban area of India Psychiatric Services, 56, 1423–8 Stein, L I and Test, M A (1980) Alternative to mental hospital treatment: I Conceptual model, treatment program, and clinical evaluation ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...
- 16
- 524
- 0
Báo cáo khoa học: " a Tool for Teaching by Viewing Computational Linguistics" potx
... are associated to only one kind of information (e.g color red associated to definitions, etc.) LSA Applications - It presents the application areas for the LSA, LSA limitations and critics Also a ... Mathematical Fundamentals - It describes the LSA algorithm The G.U.I follows the same design rules in all modules and the layout and format decisions are consistent A color and a font style are ... such as the possibility of changing parameters for the LSA algorithm and visualizing the results, or as the integrated programs for the computational lexicons tool: ManageLex (http://nats-www informatik.uni-hamburg.de/view/...
- 4
- 331
- 0
Woman And Womanhoodby A Search For Principles By C. W. Saleeby pdf
... higher animals and plants, as formerly parts of the parent individuals On the contrary, we have to accept, at least in general and as substantially revealing to us the true nature of the individual, ... throwing various hapless men about a room And only the day before I write, the papers have given us a realistic account of a demonstration by an ardent advocate of woman, the chief item of which was ... divine a thing A woman may be made Thy thoughts and feelings shall not die, Nor leave thee, when grey hairs are nigh, A melancholy slave; But an old age serene and bright And lovely as a Lapland...
- 258
- 403
- 0
A Joy For Ever, by John Ruskin docx
... be taught to a youth as soon as he can be trusted with an annual allowance, or to a young lady as soon as she is of age to be taken into counsel by the housekeeper I might, with more appearance ... strong, and a mean lust of accumulation merely for the sake of accumulation, or even of labour merely for the sake of labour, will banish at last the serenity and the morality of life, as completely, ... because the real type of a well-organized nation must be presented, not by a farm cultivated by servants who wrought for hire, and might be turned away if they refused to labour, but by a farm...
- 535
- 383
- 0
BIOELEC TROMAGNETIC HEALING A RATIONALE FOR ITS USE doc
... Committee reported that all 16 of the formerly-terminal patients appeared cured This information was concealed for decades by the the AMA as pharmaceutical economics collaborated by the Flexner Report ... natural antioxidants to neutralize free radicals rapidly Free radicals have a role in aging, illness, and death Stopping free radicals stops inflammation “Healing won’t take place until inflammation ... frequency wave to transport it to the body This works in the same way a radio transmitter carries the signal for a particular radio station so it can be received by a radio in any given area Skilling's...
- 128
- 270
- 0
báo cáo khoa học:" Dentin dysplasia type I: a challenge for treatment with dental implants" ppt
... extraction postoperative panoramic radiographs after tooth extraction and bone augmentation Figure and bone augmentation postoperative panoramic radiographs after implant setting postoperative panoramic ... iliac alveolar (below) using autogenousmaxilla (above) and the alveolar ridge augmentation of the maxilla (above) and the mandible (below) using autogenous bone grafts from the iliac crest Page ... the lacking bone, a bilateral sinus lifting procedure and a simultaneous alveolar ridge augmentation of the maxilla and the mandible using autogenous corticocancellous block and particulate bone...
- 5
- 279
- 0
A Rationale for a Biologically-based Public Exposure Standard docx
... peripheral amyloid beta are a risk factor for AD and 2) medium to high MF exposure can increase peripheral amyloid beta High brain levels of amyloid beta are also a risk factor for AD and medium ... appropriate measure of biological threshold or dose, and should not be used as the basis for a safety standard, since SAR only regulates against thermal damage 17 Summary for the Public Ms Sage ... process activated by RF at the thermal level • There is a need for a biological standard to replace the thermal standard and to also protect against cumulative effects across the EM spectrum • Based...
- 610
- 248
- 0
Báo cáo khoa học: "The "Win-Win" initiative: a global, scientifically based approach to resource sparing treatment for systemic breast cancer therapy" pdf
... Turpeenniemi-Hujanen T, Jyrkkio S, Flander M, Helle L, Ingalsuo S, Johansson K, Jaaskelainen AS, Pajunen M, Rauhala M, Kaleva-Kerola J, Salminen T, Leinonen M, Elomaa I, Isola J: Adjuvant docetaxel or ... Tamoxifen and Ovarian ablation Innovative strategic thinking and approaches should be encouraged to improve the availability and accessibility of first-line systemic anticancer treatments as part of the ... Systemic Therapy (BCST) and hope that such strategy may meet the demand for effective, affordable breast cancer care for patients who would otherwise be left without scientifically valid treatment...
- 5
- 265
- 0
Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf
... DesRosiers C, Randall M: Extracranial stereotactic radioablation: Physical principles Acta Oncol 2003, 42:882-894 Nagata Y, Takayama K, Matsuo Y, Norihisa Y, Mizowaki T, Sakamoto T, Sakamoto M, Mitsumori ... Haedinger U: Stereotactic radiotherapy of primary liver cancer and hepatic metastases Acta Oncol 2006, 45:838-847 Schefter TE, Kavanagh BD, Timmerman RD, Cardenes HR, Baron A, Gaspar LE: A phase ... Cleveland, OH, USA) The imaging data was electronically transferred to the Eclipse radiation therapy planning system (Varian Medical Systems, Palo Alto, CA, USA) Based on both free-breathing and...
- 7
- 239
- 0
báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps
... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... Road, Philadelphia, PA 19141, USA Authors’ contributions AKJ supervised all aspects of radiation treatment planning and delivery, analyzed and interpreted the patient data, and performed literature ... concurrent carboplatin and paclitaxel, followed by consolidation carboplatin and paclitaxel He was evaluated by an orthopedic surgeon (JH) for implantation of fiducial markers for IGRT because of the...
- 5
- 279
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...
- 19
- 317
- 0
Báo cáo y học: "Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS" pdf
... up and performed quantitative real-time PCR assays to measure total and circular FIV DNA forms [see Additional file 2] This PCR assay can detect and quantify the total viral DNA (represented by ... from domestic cat, Pallas' cat, and puma, respectively The FIV-Fca clade is indicated by capital letters The catalytic triad is marked by the black arrows Blue arrows show the amino acids reported ... previously characterized were used as standards in all experiments Samples, PCR-negative control (ultrapure water PCR grade) and DNA standards were run in parallel and in triplicate For the quantitative...
- 13
- 309
- 0
Báo cáo y học: " Targeted infection of HIV-1 Env expressing cells by HIV(CD4/CXCR4) vectors reveals a potential new rationale for HIV-1 mediated down-modulation of CD4" doc
... fragment, containing the poly (A) site of SV40, was amplified using (+) TAGCCCGGGATAAGATACATTGATGAGT and (-) TAGGAATTCATCATAATCAGCCATACCAC and cleaved with SmaI and EcoRI The DNA from step (A) ... GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG and (-) CCCAAGGAACAAAGCTCCTATTCTACAGTCATCAATATCCC produced a 1457 bp fragment with a 1448 bp deletion in Env (pos 6307–7755) It was cleaved with EcoRI and HpaI (C): A ... fragments were ligated into BssHII and EcoRI of pHD1 [7] (B): PCR of pNL4-3 with the terminal primers (+) CATAATAAGAATTCTGCAAC and (-) CAAGTTAACAGCACTATTC and the fusion primers (+) GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG...
- 15
- 241
- 0
Báo cáo y học: "A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention" pdf
... Foot All joints distal to the talocrural joint Ankle The talocalcaneal, talonavicular, talo-crural and distal tibial-fibular joints Knee The patellar-femoral articulation, tibial-femoral articulation ... Maltby S, Hulse M, Thomas A, Hodson A, Football Association Medical Research Programme: The Football Association Medical Research Programme: an audit of injuries in professional football–analysis ... proportion of treatment was provided to asymptomatic areas, particularly when joint based therapy was provided With regards to joint based therapies delivered for asymptomatic benefit, treatment was predominantly...
- 8
- 367
- 0
Báo cáo y học: " Manual therapy with and without vestibular rehabilitation for cervicogenic dizziness: a systematic review" doc
... orthopaedic manual and vestibular physical therapy comanagement The Journal of Manual & Manipulative Therapy 2006, 14(3):56-68 38 Moher D, Liberati A, Tetzlaff J, Altman DG, PRISMA Group: Preferred ... dizziness: A case report illustrating manual and vestibular physical therapy comanagement The Journal of Manual & Manipulative Therapy 2006, 14(3): E56-E68 91 Cooksey FS: Rehabilitation in vestibular ... Callies R: Manual diagnosis and therapy in cervical giddiness Manuelle Medizin 1993, 31(4):77-81 83 Bracher ESB, Almeida CIR, Almeida RR, Duprat AC, Bracher CBB: A combined approach for the treatment...
- 11
- 475
- 0
Báo cáo y học: "Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention." pot
... Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention Wayne Hoskins* and Henry Pollard Department ... ethics committee approval it has been retracted References Hoskins W, Pollard H A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb ... Pollard hpollard@optushome.com.au Abstract The journal has been informed by its publisher BioMed Central that contrary to the statement in this article [Wayne Hoskins, Henry Pollard, Chiropractic &...
- 2
- 203
- 0
Enhancement of domestic wastewater treatment under long sewer line condition in a laboratory set-up by Aspergillus niger bioaugmentation
... phosphatase (alkaline, acid and phosphohydrolase), cellulase (α-glucosidase, β-galactosidase, α-mannosidase), esterase (C4 and lipase C8) and protease (leucine aminopeptidase) The enzymatic activities ... to give an accurate tool for sanitary engineers This could be more economical for wastewater treatment as well as for the management of A niger waste biomass originating from fermentation industries ... of A niger, and special thanks to Dr Pierre Wattiau for suggestions and Hélène-Christine Massart for analytical support REFERENCES Boczar B A. , Begley W M and Larson R J (1992) Characterisation...
- 7
- 609
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...
- 9
- 522
- 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL-1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...
- 11
- 653
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25