a post labeling approach for the characterization and quantification of rna modifications based on site directed
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... lemma I stem matte mattino di andare andare matt mattin di vad and ending d a m da_bello dn_oggctto dv 1_andare I dv2 andar© synt=categ change altered lemma easona label adj.qualific noun.common ... convenient to draw a distinction between data: on one hand the set of lemmata, and on the other the sets of affixes, alterations, endings and enclitics The former (which is the most relevant and needs ... unlimiled, and sometimes make insufficient even a common dictionary A different approach takes two different lists: one containing the lemmata of the language and the other the logic rules of derivations,...
- 6
- 378
- 0
A multiscale modeling approach for the progressive failure analysis of textile composites
... scales are available However, there is still a strong demand for a computational approach to implement the mechanical analysis for a macroscopic structure based on the micro-physical phenomena ... presents the central path of the horizontal yarn (along x-direction) and the cross sections of the perpendicular yarns It can be seen that the central path of the yarn in the plain woven RVE model was ... weaving It is normally integrated as a tubular form over a cylindrical mandrel Fiber yarns are interwound together in the braided performs The tubular form is available in biaxial and triaxial...
- 282
- 261
- 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
... empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International ... expectations approach Christian Bauer Paul De Grauwe, Stefan Reitz 12 2007 Money and housing evidence for the euro area and the US Claus Greiber Ralph Setzer 13 2007 An affine macro-finance term ... Hoffmann Sondergaard, Westelius 34 2007 Factor-MIDAS for now- and forecasting with ragged-edge data: a model comparison for German GDP Massimiliano Marcellino Christian Schumacher 35 2007 Monetary...
- 40
- 468
- 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... feedback linearization control to nonlinear systems [111, Indeed, the nonlinear feedback linearization scheme is based on a coordinate transformation and an input transformation as well But the main ... therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features...
- 8
- 517
- 1
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... present a method based on dynamic modelling that allows for the quantification and visualization of cellular rates of metabolite interconversion during an acclimation process incorporating environmental ... 6phosphate and 40 mm glucose 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and ... synthesis was described by the mass action rate law: rA!B ðtÞ ¼ k Á cA ðtÞ In this reaction kinetic, the reaction rate rAfiB(t) depends on the substrate concentration cA(t) and the rate constant k The...
- 13
- 707
- 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf
... redefinition of literal and nonliteral as word senses, the alteration of the similarity scores used, and the addition of learners and voting, SuperTags, and additional context For all our models and algorithms, ... Nonliteral precision and recall are defined similarly Average precision is the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of ... examine iterative augmentation Then we discuss the structure and contents of the example base and the potential for expansion After an initial run for a particular target word, we have the cluster...
- 8
- 447
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... increased collaboration and integration of TB and HIV programs and services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional Healthcare Providers A critically ... current paradigm and a proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes ... patients with both TB and HIV disease in need of treatA Common TB and HIV Paradigm An Alternative TB and HIV Paradigm Collaboration of Programs National TB Program TB Services Sputum Collection...
- 5
- 469
- 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx
... captured However, limited dynamic range of the CCD and quantization in the Analog/Digital conversion often lead to data loss that typically appears as saturation 6 EURASIP Journal on Image and ... pixel, the intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear Gaussian fit is performed on the ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol 25,...
- 13
- 569
- 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps
... cranio-caudally distributed along the bronchial trees Therefore cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial ... not in the surgical field, the suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters ... by the introduction of PACS; and the use of coronal images is now more feasible The coronal image has some radiological advantages compared to the axial image The number of images used for coronal...
- 5
- 657
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... NorthStar is an integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national ... NorthStar is a major product of the ReBEQI project It is a software program that packages information on the design and evaluation of evidence -based QI interventions into an integrated, easily accessible, ... browser -based version and an HTML help file version, and will soon be available in French and Italian, as well as English While the focus of NorthStar is on QI programmes at a national or regional level,...
- 7
- 429
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... incubated for 4–5 days and matured for 20–24 h and analyzed for mature DC content and function as above Determination of mDC yield and phenotype Isolated cells were washed in DC-CM and viable ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases, ... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+...
- 11
- 469
- 0
Báo cáo khoa học: "A validated clinical approach for the management of aspergillosis in critically ill patients: ready, steady, go" pdf
... Critical Care Vol 10 No Garnacho-Montero and Amaya-Villar Van de Woude et al [1] propose a clinical algorithm based on the criteria defined by an international conference on the diagnosis of aspergillosis ... uncertainty and doubt Nowadays, the isolation of Aspergillus spp in a critically ill patient is not an exceptional curiosity Definitions proposed by the European Organisation for the Research and ... patients if semiquantitative culture of bronchoalveolar lavage was not positive [13], a criterion not universally accepted Moreover, a high resolution CT scan is nowadays mandatory and a normal...
- 2
- 267
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
- 11
- 467
- 0
AN INTEGRATED ATOM CHIP FOR THE DETECTION AND MANIPULATION OF COLD ATOMS USING a TWO PHOTON TRANSITION
... trap is stable only if the magnetic moment of the atom adiabatically follows the direction of the magnetic field In both classical and quantum mechanics, the magnetic moment of atom adiabatically ... all the atoms are accumulated in the other ground hyperfine state 52 S1/2 , F = The laser excitation stops as the linewidths of the transition and of the laser are much smaller than the separation ... the magnetic moment, m is the mass of the atom, ωx and ω⊥ are the trap frequencies along the axial and radial direction respectively For typical Ioffee traps the radial frequency is larger than...
- 170
- 846
- 0
On the performance characterization and evaluation of RNA structure prediction algorithms for high performance systems
... the performance evaluation and characterization of parallelized algorithms on high performance computing systems The domain we have chosen is bio-informatics and in particular RNA secondary structure ... key attributes for a stem - the length of the stem and the quality of the base pairs The quality of the base pairs is determined if they are canonical (such as Watson-Creek) or non-canonical (such ... hydrogen bonds Thus, in a two-stranded form, each strand effectively contains all necessary information, redundant with its partner strand RNA molecules are single-stranded and not appear as a double-helix...
- 250
- 285
- 0
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... Preliminary Notions Till and Hand [41] investigated ways of segmenting1 the behaviour profiles They came out with the conclusion that, based on the application form variables, a reasonably accurate ... external bureaus, data from application forms and data related to repayment histories and usages The latter are extra information that is not available when performing the credit scoring Thus, the ... order to perform the classification of the new applicants, a metric defined on the space of application data and a decision rule are needed The metric measures how similar new applicants and existing...
- 184
- 497
- 0
A new solution approach for the inventory routing problem using vehicle routing problem constructive heuristic
... horizon, deterministic demand model of the IRP They considered a system where the customers face a constant demand rate, and have a finite local inventory capacity The first phase of the solution ... derived from the analysis of the subtour elimination constraints, as well as from other observations made on the model The inequalities were used as cuts in a constraint-relaxation algorithm: a lower ... refers to a set of MVRPD demand points that emanate from the same IRP customer i and that all share the same geographical location Cumulated quantities Given the nature of the inventory constraints...
- 109
- 483
- 0
A framework for the analysis and assessment of accountability arrangements in the public domain
... about the quality of the provision of information by the actor, the quality of the procedure, and the quality of the forum’s judgement, afford a framework for a normative analysis of accountability ... conduct of the organisation, is from a moral standpoint a far more adequate strategy Under this approach, each individual is judged on the basis of his actual contribution instead of on the basis of ... relations, the forums are not principals of the actors, for example courts in case of legal accountability or professional associations in case of professional accountability The obligation that...
- 37
- 535
- 0
Tài liệu Guidelines for the Prevention and Treatment of Opportunistic Infections Among HIV-Exposed and HIV-Infected Children pdf
... greater with the oral solution than with capsules and absorption of the capsule formulation varies Ketoconazole absorption also varies, and therefore neither itraconazole capsules nor ketoconazole ... systemically absorbed oral antifungal azole compounds (e.g., ketoconazole or fluconazole) for control of oral and esophageal candidiasis (267) Early detection and treatment of candidemia can decrease ... of primary infection rather than the reactivation disease commonly observed among adults (165) Identification and treatment of the source patient and evaluation of all exposed members of the household...
- 177
- 675
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25