a possible radical procedure against localized prostate cancer with almost no postoperative urinary incontinence
PULMONARY HYPERTENSION – FROM BENCH RESEARCH TO CLINICAL CHALLENGES pot
... Feenstra and W J van der Laarse Clinical Evaluation and Diagnostic Approaches for Pulmonary Hypertension 167 Assessment of Structural and Functional Pulmonary Vascular Disease in Patients with PAH ... 263 Alessandro Domenici, Remo Luciani, Francesco Principe, Francesco Paneni, Giuseppino Massimo Ciavarella and Luciano De Biase Part Chapter 15 221 Special Considerations in Evaluation and Management ... extracellular L-arginine and its transport through cationic amino acid transporter-1 (CAT-1), localized in the caveolae, are available for eNOS activity L-arginine found in different intracellular compartments...
- 338
- 348
- 0
Báo cáo y học: " Involvement of mast cells in monocrotalineinduced pulmonary hypertension in rats" pot
... pulmonary artery muscularization In each rat, 80 to 100 intra-acinar arteries (20 to 50 μm diameter) were categorized as muscular, partially muscular, or nonmuscular In addition, arteries of the same ... [17] and congenital heart diseases associated with early pulmonary vascular diseases [18]; however, quantitative data on pulmonary MCs have been lacking in the PH patients In line with the literature, ... higher along the perivascular space and in particular, a remarkable increase was observed around intra-acinar vessels Corroborating our findings, Miyata et al have described more MCs around the...
- 11
- 285
- 0
Báo cáo y học: "Inhaled nitric oxide in persistent pulmonary hypertension of the newborn refractory to high-frequency ventilatio" ppsx
... 0.0003* a/ A during INO OI, oxygenation index; a/ A, arterial/alveolar oxygen ratio; INO, inhalational nitric oxide All values shown as mean ± SEM; *P < 0.05 three had congenital diaphragmatic hernia ... thereafter were weaned and HFOV was replaced by a conventional ventilator An arterial/alveolar oxygen (a/ A) ratio less than 0.22 was used to define failure of HFOV and INO therapy, if INO reached ... during INO therapy The average age when INO was started was 2.6 days (range 1–11 days) The mean duration of INO used in all neonates was 4.6 days (range 1–10 days) Three neonates responded to INO...
- 4
- 175
- 0
Báo cáo y học: "Prophylactic antibiotic treatment is superior to therapy on-demand in experimental necrotising pancreatitis" pptx
... start antibiotic therapy as early as possible after the diagnosis of pancreatic necrosis has been made This is of particular relevance because the latest clinical trials Page of (page number not ... treatment of acute pancreatitis: a look at established paradigms Ann Surg 2006, 243:154-168 18 Mazaki T, Ishii Y, Takayama T: Meta-analysis of prophylactic antibiotic use in acute necrotizing pancreatitis ... inflammation and acinar necrosis using a scoring system from (no injury) to (severe injury) [26] Data analysis and statistics Data is presented as mean ± standard error of the mean (SEM) Data was analysed...
- 9
- 302
- 0
Báo cáo y học: " Effects of inhaled iloprost on right ventricular contractility, right ventriculo-vascular coupling and ventricular interdependence: a randomized placebo-controlled trial in an experimental model of acute pulmonary hypertension" ppt
... performance and cardiac loading conditions in an experimental model for acute PHT as well as in healthy animals with intact and pharmacologically blocked ANS Materials and methods This investigation ... the data acquisition and the statistical analysis, and wrote the manuscript PC wrote the software algorithms for the data analysis, participated in the statistical analysis and helped to draft ... animals with and without ANS blockade Parameters of LV afterload and contractility remained unchanged after the inhalation of iloprost (data not shown) Figure Discussion Our data confirm that inhaled...
- 13
- 231
- 0
Tài liệu Educator Supply and Demand in the South African Public Education System ppt
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
- 164
- 448
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... to speak) domains A full factorial design produced 36 health states for valuation The health states were stratified into mild, moderate and severe classifications A sample of health states defined ... predicted and actual values for selected health state classifications: mean level (ML) and random effects (RE) models Health State Actual mean Estimated mean (ML) model Estimated mean (RE) model ... ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed to the writing of the manuscript JB designed and managed the valuation survey, analysed...
- 8
- 590
- 0
Báo cáo y học: "Cold hands — strained heart? Advances in the management of Raynaud’s phenomenon and pulmonary hypertension" ppt
... [7,8] Data demonstrating the efficacy of ERAs in SScl-associated PAH and in patients in World Health Organisation Functional Class II are awaited The combined vasodilator/antiproliferative/ antifibrotic ... sildenafil, when added to conventional treatment for PAH, demonstrated that both agents improved the haemodynamics and exercise capacity, compared with baseline values, and that there was no significant ... exercise capacity [18] The apparent efficacy of PDE inhibitors in PAH has made them attractive candidates for treating RP Case reports are encouraging but controlled trials are required These approaches...
- 3
- 541
- 0
Báo cáo y học: "Role of chymase in cigarette smoke-induced pulmonary artery remodeling and pulmonary hypertension in hamsters" doc
... Expression, localisation and function of ACE and chymase in normal and atherosclerotic human coronary arteries Vascul Pharmacol 2005, 42:99-108 Miyazaki M, Takai S, Jin D, Muramatsu M: Pathological roles ... Chetta A, Saetta M, Baraldo S, D’Ippolito R, Castagnaro A, Neri M, Olivieri D: Chymase-positive mast cells play a role in the vascular component of airway remodeling in asthma J Allergy Clin Immunol ... and airway inflammation Radiology 2003, 228:85-94 17 Battaglia S, Mauad T, van SAM, Vignola AM, Rabe KF, Bellia V, Sterk PJ, Hiemstra PS: Differential distribution of inflammatory cells in large...
- 10
- 354
- 0
Báo cáo y học: " Beta-estradiol attenuates hypoxic pulmonary hypertension by stabilizing the expression of p27kip1 in rats" ppsx
... (forward chain) 5’-CTTGGAGAAGCACTGCCGAGAT-3’ and (reverse chain) 5’-CCCTGGACACTGCTCCGCTA-3’, for Skp-2 (396 bp) were (forward) 5’-TAAGCGTTAGGTCTTTGGAA3’ and (reverse) 5’-TGGTTGTGTGTGTCTGTGTC3’, Page ... Inc, Shanghai, China) Statistical analyses All values were expressed as mean ± SD Statistical analysis was processed by using one-way ANOVA, followed by LSD test for post hoc multiple comparisons ... rats (a) Hematoxylin and eosin staining of pulmonary arterioles (original magnification ×20) (b) Medial wall thickness (MT%) of pulmonary arterioles (c) Medial wall area (MA%) of pulmonary arterioles...
- 11
- 462
- 0
Báo cáo y học: " Effect of chemokine receptor CXCR4 on hypoxia-induced pulmonary hypertension and vascular remodeling in rats" pps
... removed and anesthetized with intraperitoneal ketamine (80 mg/kg) and diazepam (5 mg/kg) Animals were placed on a warming blanket to maintain body temperature at 37°C mPAP was measured via a catheter ... percent wall thickness was calculated as average diameter of the external elastic lamina minus the average diameter of internal elastic lamina divided by the average diameter of external elastic lamina ... was read directly Statistical Analysis Statistics was performed using the computer program Statview (SAS Institute Inc., Cary, NC) with the analysis of variance (ANOVA) If ANOVA was significant,...
- 11
- 261
- 0
Báo cáo y học: " Protective effects of hydrogen-rich saline on monocrotaline-induced pulmonary hypertension in a rat model" potx
... Ohsawa I, Shinmura K, Tamaki K, Kimura K, Endo J, Katayama T, Kawamura A, Kohsaka S, Makino S, Ohta S, Ogawa S, Fukuda K: Inhalation of hydrogen gas reduces infarct size in the rat model of myocardial ... Kamezaki F, Tasaki H, Yamashita K, Tsutsui M, Koide S, Nakata S, Tanimoto A, Okazaki M, Sasaguri Y, Adachi T, Otsuji Y: Gene transfer of extracellular superoxide dismutase ameliorates pulmonary ... Changes in maximal performance of inspiratory and skeletal muscles during and after the 7.1-MPa Hydra 10 record human dive Eur J Appl Physiol 2000, 81:325-328 Shirahata S, Kabayama S, Nakano...
- 8
- 257
- 0
Báo cáo y học: " Adrenomedullin in inflammatory process associated with experimental pulmonary fibrosis" pot
... or reactive oxygen and nitrogen intermediates (ROI and RNI, respectively) may cause DNA breakage and can lead to PARP activation Although PARP activation may enhance the repair of damaged DNA, ... 155(2):446-456 26 Hamaguchi Y, Nishizawa Y, Yasui M, Hasegawa M, Kaburagi Y, Komura K, Nagaoka T, Saito E, Shimada Y, Takehara K, et al: Intercellular adhesion molecule-1 and L-selectin regulate bleomycin-induced ... Histological examination Methods Animals Male CD-1 (CD1(ICR) mice (25-35 g; Harlan Nossan; Italy) were housed in a controlled environment and provided with standard rodent chow and water Animal care was...
- 12
- 177
- 0
Báo cáo y học: " Therapeutic efficacy of TBC3711 in monocrotaline-induced pulmonary hypertension" pot
... other important pathological characteristics, such as initial endothelial injury, increased perivascular inflammation and de novo muscularization of small pulmonary arteries are shared features between ... different parameters measured by invasive and echocardiographic approaches in monocrotaline-injected rats The Spearman analysis demonstrated a significant correlation between invasive measurements ... from day 21-35 after MCT-injection accompanied by echocardiography measurement and blood gas analysis (a) Pulmonary artery acceleration time (ACT), (b) Cardiac output (CO), (c) Total pulmonary...
- 13
- 230
- 0
Báo cáo y học: " Endothelial-like cells in chronic thromboembolic pulmonary hypertension: crosstalk with myofibroblast-like cells" pptx
... online analysis For each PCR reaction, the excel sheet calculated two normalized average Ct values, a paired t test P value and a fold change Data normalization was based on correcting all C t values ... NPPB, PLAU and RHOB are related to endothelial cell activation, and are part of the extracellular matrix (ECM) molecules ANXA5 and PLAU are related to endothelial cell activation with regard to ... Co-Regulators of Autophagy and Apoptosis Regulation of Autophagy: Chaperone-Mediated Autophagy Regulation of Autophagy: Co-Regulators of Autophagy and Apoptosis BH3 interacting domain death agonist...
- 16
- 305
- 0
Báo cáo y học: "Impact of interleukin-6 on hypoxia-induced pulmonary hypertension and lung inflammation in mice" ppt
... CTCTGGGAAATCGTGGAAATG GACTATTTATGCTCCCTGAATGATCA CAATTTTGACCCCGTGGATAA TCTGGGCCTGCTGTTCACA TGGACAAGCAGTGTGTCTACTTCTC CCGCTTCCGCTACCATCA ACGGTACTTTGGATACTGTTTGCA AAGTGCATCATCGTTGTTCATACA ACTCACAGATGGCGTTGACAAG ... ACTCACAGATGGCGTTGACAAG GATAATTCTTCTGAGTTGGTCACTGA GGATCATCTTGCTGGTGAATGA GACGCGCTCGGGAGTGT CAGGCTGGCAGAGGTCTCA GGCCATGGAGTCACCGATT Page of 13 (page number not for citation purposes) Respiratory Research ... hypoxia and in normoxia In brief, 50 μl of lung homogenate was incubated with 50 μl of assay diluent for h at room temperature in a 96-well plate coated with a monoclonal antibody against IL-6 After...
- 13
- 307
- 0
Báo cáo y học: " Nitric oxide synthases in infants and children with pulmonary hypertension and congenital heart disease" ppsx
... eNOS, (C and D) iNOS, (E and F) nNOS (A) Cardiac patient small pulmonary artery showing mild endothelial positivity for eNOS Intra-alveolar macrophages and alveolar lining cells also positive with ... endothelium and media Intra-alveolar macrophages stained also strongly positive (D) Small pulmonary artery of control patient showing no significant iNOS positivity Intra-alveolar macrophages were ... hypertension and from control patients of similar age (A) Staining for eNOS was quantified separately in pulmonary vascular endothelium, respiratory endothelium, and alveolar macrophages of controls and...
- 9
- 318
- 0
Báo cáo y học: "Collagen V-induced nasal tolerance downregulates pulmonary collagen mRNA gene and TGF-beta expression in experimental systemic sclerosis" doc
... TGGCCCTGTTTGCTTTTTAT 204 COL V AF451329 GTCCCCCTCAAACACTTCCT TCTCAGCGTCCACAAGAAAA 154 GAPDH AB231852 GTGAGTTTCCCGTTCAGCTC AGGTCATCCACGACCACTTC 202 Velosa et al Respiratory Research 2010, 11:1 http://respiratory-research.com/content/11/1/1 ... inoculated with Freunds adjuvant (CTFA) was tolerated by nasal route with collagen V, initiated 150 days after immunization All animals were sacrificed at 210 days The animal procedures were approved ... Tsukamasa Y, Nakamura Y, Kawabata M, Ohtsuki K: Simple and rapid chromatographic purification of Collagen V from a pepsin digest of porcine instestinal connective tissue, an unmanageable starting...
- 10
- 268
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25