a plant derived sesquiterpene lactone with promising anti inflammatory and anticancer effects
Báo cáo y học: "Anti-inflammatory and arthritic effects of thiacremonone, a novel sulfurcompound isolated from garlic via inhibition of NF-κB" pptx
... 14 Rahman K: Historical perspective on garlic and cardiovascular disease J Nutr 2001, 131:977S-979S Tanaka S, Haruma K, Yoshihara M, Kajiyama G, Kira K, Amagase H, Chayama K: Aged garlic extract ... metabolism of carcinogens [5], and have anti- oxidative activities [6] as well as anti- inflammatory effects in vitro and in vivo [7-13] Despite their widespread medicinal use and anti- inflammatory ... of arthritic hind paws and HJ isolated thiacremonone from garlic and provided SBH participated in data analysis and helped to draft the manuscript All authors read and approved the final manuscript...
- 13
- 724
- 0
Báo cáo y học: "Anti-inflammatory and antiarthritic effects of piperine in human interleukin 1β-stimulated fibroblast-like synoviocytes and in rat arthritis models" pps
... Anand P, Kunnumakkara AB, Newman RA, Aggarwal BB: Bioavailability of curcumin: problems and promises Mol Pharm 2007, 4:807-818 Iwashita M, Saito M, Yamaguchi Y, Takagaki R, Nakahata N: Inhibitory ... carrageenan-induced arthritis and checked daily for days With progression of arthritis, redness and swelling of the ankle joints and arthritic pain started to appear and reached a maximum on day after ... 9:R80 Yoo EA, Kim SD, Lee WM, Park HJ, Kim SK, Cho JY, Min W, Rhee MH: Evaluation of antioxidant, antinociceptive, and anti- inflammatory activities of ethanol extracts from Aloe saponaria Haw Phytother...
- 9
- 369
- 0
TSG-6: AN INDUCIBLE MEDIATOR OF PARACRINE ANTI-INFLAMMATORY AND MYELOPROTECTIVE EFFECTS OF ADIPOSE STEM CELLS
... Transmigration Rate (% total) A a ab b NC b vehicle PPK ASC TSG6 Thrombin D ab Transmigration Rate (% total) Transmigration Rate (% total) C ab a a b NC vehicle PPK a a a a NC vehicle PPK CMA ... attenuate lymphocyte proliferation Mononuclear cells (MNC) activated by anti- CD3 and anti- CD28 show a significant increase in proliferation compared with inactivated MNC and was attenuated by ASC, ... Dr Patricia Gallagher, Dr Johnathan Tune, and Dr Michael Sturek They cheer for my progress and caution me of pitfalls in front They are my guardian angels I also thank American Heart Association...
- 148
- 162
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... permeability transition pore in yeast mitochondria J Biol Chem, 272, 21104– 21112 Yamada A, Yamamoto T, Yoshimura Y, Gouda S, Kawashima S, Yamazaki N, Yamashita K, Kataoka M, Nagata T, Terada H et al (2009) ... static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared with ... Alapprogram (OTKA), Magyar ´ ´ ´ Tudomanyos Akademia (MTA), Nemzeti Kutatasi ´ ´ ´ ´ ¨ es Technologiai Hivatal (NKTH), and Egeszsegugyi ´ ´ Tudomanyos Tanacs (ETT) to V Adam-Vizi, and OTKA-NKTH grant...
- 15
- 505
- 0
Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot
... the angle between femur and shank - right and left ankle dorsiflexion: the angle between shank and foot Statistical analysis Continuous data were summarised in terms of means and standard deviation ... Clinical assessment in Group APA (Adapted Physical Activity) and in Group NSPA (Non-Specific Physical Activity) at baseline and months Group APA baseline Group NSPA after months p mean SD mean SD ... first metatarsal head, left first metatarsal head, right fifth metatarsal head, left fifth metatarsal head During posture analysis, in order to relate the displacement of the marker arrays to the...
- 11
- 557
- 0
báo cáo khoa học: " Human serum-derived hydroxy long-chain fatty acids exhibit anti-inflammatory and anti-proliferative activity" pot
... University of Saskatchewan, Saskatoon, Saskatchewan, Canada Authors’ contributions All authors have read and approved the final manuscript SR: Lead author, wrote the manuscript, directed and oversaw the ... Page 13 of 13 58 Kriete A, Mayo KL: Atypical pathways of NF-kappaB activation and aging Exp Gerontol 2009, 44:250-255 59 Adler AS, Kawahara TL, Segal E, Chang HY: Reversal of aging by NFkappaB ... Beta Actin Real-time PCR primers used were as follows: NOS2 forward, CACCTTGGAGTTCACCCAGT; NOS2 reverse, ACCACTCGTACTTGGGATGC; COX2 forward, CCCCCACAGTCAAAGACACT; COX2 reverse, CTCATCACCCCACTCAGGAT;...
- 13
- 257
- 0
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
... yucca in preventing arthritis by anti- inflammatory activity Yucca contains anti- inflammatory polyphenolics such as resveratrol and yuccaols A, B, C, D and E [18,19] Yucca bark and whole yucca plant ... of yucca on arthritis could involve antiprotozoal, anti- oxidant and anti- bacterial activities As previously mentioned, the drug metronidazole attenuates gastrointestinal inflammation and can prevent ... yucca include steroidal saponins and polyphenolics such as resveratrol and yuccaols Saponins may have anti- arthritic effects associated with their anti- protozoal activity Yucca polyphenolics may...
- 7
- 369
- 0
Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc
... congenital anomalies such as renal agenesis, cardiac anomalies, pulmonary hypoplasia, pectus excavatum, and anasarca [13] A majority of cases (83%) present in early post-natal period with respiratory ... X-ALD, adrenal insufficiency and CPAM The early and accurate diagnosis and treatment of patients with X-ALD and its complications can delay progressive degenerative changes and attenuate further ... detectable anti- adrenal antibodies and a non-reactive purified protein derivative skin test He was started on hydrocortisone and fludrocortisone and had a surgical removal of the CPAM a few weeks...
- 5
- 260
- 0
Báo cáo y học: "A 60-year-old man with chronic renal failure and a costal mass: a case report and review of the literature" docx
... Radiat Med 2006, 24:631-634 Yapar AF, Aydin M, Reyhan M, Bal N, Yapar Z, Yologlu NA: Simultaneous visualization of a mandibular brown tumor with a large parathyroid adenoma on Tc-99 m MIBI imaging ... upper and the lower limbs He had a translumbar hemodialysis catheter The remaining physical examination was unremarkable The patient had stable vital signs and had no signs of systemic inflammatory ... Fernandez-Sanroman J, Anton-Badiola IM, Costas-Lopez A: Brown tumor of the mandible as first manifestation of primary hyperparathyroidism: diagnosis and treatment Med Oral Patol Oral Cir Bucal...
- 5
- 327
- 0
Báo cáo khoa học: "A comparison of transcranial Doppler with near infrared spectroscopy and indocyanine green during hemorrhagic shock: a prospective experimental study" ppsx
... line) and at hemodynamic decompensation (orange line) Medical Systems, Natick, MA, USA) If cardiovascular variables or BIS indicated a reduced depth of anesthesia, additional propofol and sufentanil ... it with transcranial Doppler ultrasound, an established method of monitoring cerebral hemodynamics at the bedside Materials and methods Animal Investigation Committee, and animals were managed ... Beer-Lambert law and absolute concentration changes are calculated by proprietary software (Hamamatsu Photonics) ICG was injected as bolus in the proximal port of the PAC at a dose of 0.1 mg·kg-1 and...
- 8
- 338
- 0
Báo cáo y học: "A multicentre case-control study of nonsteroidal anti-inflammatory drugs as a risk factor for severe sepsis and septic shock" docx
... and standard interviews were conducted by physicians An exhaustive list of all oral and parenteral NSAIDs (including their international nonproprietary name and brand name) was provided to each ... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (
- 7
- 467
- 0
Báo cáo y học: " Anti-inflammatory and immunosuppressive drugs and reproduction" pot
... that this can bind and inactivate activated coagulation factor X, are logical alternatives for lowmolecular-mass heparin The pentasaccharide fondoparinux can be administered once daily subcutaneously ... pancreas transplantation in the cyclosporin era: report from the International Pancreas Transplant Registry Transplantation 1998, 65:524-527 186 Shaheen FAM, AI-Sulaiman MH, AI-Khader AA: Long-term ... Transplantation 2004, 77:897-902 194 Jain AB, Reyes J, Marcos A, Mazariegos G, Eghtesad B, Fontes PA, Cacciarelli TV, Marsh JW, de Vera ME, Rafail A, et al.: Pregnancy after liver transplantation...
- 19
- 324
- 0
Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin." potx
... 12 Kasperska-Zajac A, Brzoza Z, Rogala B: Platelet-activating factor (PAF): a review of its role in asthma and clinical efficacy of PAF antagonists in the disease therapy Recent Pat Inflamm Allergy ... on PAF basic metabolic enzymes, PAF-CPT and lyso PAF-AT of rabbit leukocytes as well as rabbit plasma PAF-AH Materials and methods Materials and instruments Centrifugations were performed in an ... sepsis and shock states indicates a role for PAF in endotoxin associated lethality, activation of inflammatory blood cells with release of mediators, cardiovascular failure and increased vascular...
- 11
- 347
- 0
Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin" doc
... 12 Kasperska-Zajac A, Brzoza Z, Rogala B: Platelet-activating factor (PAF): a review of its role in asthma and clinical efficacy of PAF antagonists in the disease therapy Recent Pat Inflamm Allergy ... on PAF basic metabolic enzymes, PAF-CPT and lyso PAF-AT of rabbit leukocytes as well as rabbit plasma PAF-AH Materials and methods Materials and instruments Centrifugations were performed in an ... sepsis and shock states indicates a role for PAF in endotoxin associated lethality, activation of inflammatory blood cells with release of mediators, cardiovascular failure and increased vascular...
- 11
- 295
- 0
Báo cáo y học: " Potent anti-inflammatory and antinociceptive activity of the endothelin receptor antagonist bosentan in monoarthritic mice" ppt
... induction (baseline) and on days 1, 3, 7, 14, and 21 of AIA, secondary mechanical hyperalgesia was determined on ipsi- and contralateral hindpaws by using a dynamic plantar aesthesiometer (Ugo Basile, ... triplicate, and means were taken as mechanical hyperalgesic thresholds Secondary thermal hyperalgesia was assessed at hindpaws with an algesiometer (Ugo Basile) as Imhof et al Arthritis Research ... administration of the mixed ETA and ET B endothelin receptor antagonist bosentan and the ET A -selective antagonist ambrisentan on pain-related behavior, inflammation, and histopathological manifestations...
- 9
- 224
- 0
Báo cáo y học: " Anti-inflammatory and anti-infectious effects of Evodia rutaecarpa (Wuzhuyu) and its major bioactive components" docx
... Tominaga K, Higuchi K, Hamasaki N, Tanigawa T, Sasaki E, Watanabe T, Fujiwara Y, Oshitani N, Arakawa T, Ishii E, Tezuka Y, Nagaoka T, Kadota S: Antibacterial activity of a Chinese herb medicine, ... anti- inflammatory relative effects of Evodia rutaecarpa and its bioactive components with potential clinic applications The known mechanisms for anti- inflammatory effects of Evodia rutaecarpa ... 95 Yamahara J, Yamada T, Kitani T, Naitoh Y, Fujmura H: Antianoxic action and active constituents of Evodia Fructus Chem Pharm Bull (Tokyo) 1989, 37(7):1820-1822 96 Yamahara J, Yamada T, Kitani...
- 8
- 518
- 0
Applied biochemistry and biotechnology mélody dutot, roxane fagon, marc hemon, patrice rat antioxidant, anti inflammatory, and anti senesce
... vitamin B2, and coenzyme Q10 have antioxidant properties Diets containing an abundance of fruit and vegetables are protective against a variety of diseases, particularly cardiovascular disease and ... a network of antioxidant systems, as well as a functioning antioxidant defense system A hallmark of age-related dysfunction is the organism's inability to modulate redox homeostasis Antioxidant ... by free radicals Cofactors of antioxidant enzymes include manganese, zinc, copper, and selenium In addition, many vitamins such as vitamins C, E, A (beta-carotene) and nutrients such as lutein,...
- 7
- 370
- 0
Pyrazole derivatives as antitumor, anti inflammatory and antibacterial pdf
... 1357-1366 Bekhit, A. A.; AbdelRahman, H.M.; Guemei, A. A.; Synthesis and Biological Evaluation of Some Hydroxypyrazole Derivatives as Anti inflammatory Antimicrobial Agents Archiv der Pharmazie, 2006, ... evaluation of some pyrazole derivatives as anti- inflammatoryantimicrobial agents Bioorganic & medicinal chemistry, 2004, 12, 1935-1945 Tanitame, A. ; Oyamada, Y.; Ofuji, K.; et al Synthesis and antibacterial ... AGENTS AS ANTI- 3.1 COX Inhibitory Activity Nonsteroidal anti- inflammatory drugs (NSAIDs) are commonly used for the treatment in various inflammatory diseases such as arthritis, rheumatisms and...
- 10
- 437
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
... trichloroacetic acid The A5 04 was measured and the c-glutamyl hydroxamate produced was quantified using commercial c-glutamyl hydroxamate as standard Control assays were performed in the absence of ATP ... purification (Fig and data not shown) The final fractions contained three protein bands with apparent molecular masses of 70, 47 and 45 kDa on SDS/PAGE that were most abundant in the fractions containing ... washing (see Materials and methods) and run on SDS/PAGE and stained with Coomassie blue Molecular mass standards (in kDa) are phosphorylase (97), bovine serum albumin (66), ovalbumin (43), carbonic...
- 7
- 457
- 0
báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt
... keratinocytes Implications for normal and impaired wound healing J Biol Chem 1995, 270:12607-12613 Saaristo A, Tammela T, Farkkila A, Karkkainen M, Suominen E, YlaHerttuala S, Alitalo K: Vascular ... display cellular characteristics of senescence J Vasc Surg 1998, 28:876-883 Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga V: Dermal fibroblasts from venous ulcers are unresponsive ... Quattrini C, Tavakoli M, Jeziorska M, Kallinikos P, Tesfaye S, Finnigan J, Marshall A, Boulton AJ, Efron N, Malik RA: Surrogate Markers of Small Fiber Damage in Human Diabetic Neuropathy Diabetes...
- 9
- 487
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25