0

a new representation for the semantic differential scale

Báo cáo y học:

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo khoa học

... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+ ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases,...
  • 11
  • 469
  • 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Kĩ thuật Viễn thông

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...
  • 10
  • 634
  • 1
báo cáo hóa học:

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Hóa học - Dầu khí

... proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes the need for increased ... Several individual projects assessing the feasibility of various collaborative and integrative efforts at the healthcare delivery level in urban and rural areas have been carried out or are ongoing ... programs.[18] National-level examples such as these can serve as models that other countries can adopt and implement Page of (page number not for citation purposes) Journal of the International AIDS...
  • 5
  • 469
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Hóa học - Dầu khí

... has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information ... for each one (Figure 5) For each pixel, the intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear ... vertical Gaussian stripes The initial pass is captured with only the display device in the scene to acquire a base case for the Gaussian parameters σ and X0 The next pass of the stripes is captured...
  • 13
  • 569
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

Báo cáo khoa học

... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate ... laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can be seen in the canals ... that the allergic skin reaction of humans to quin-urushiol is still treated as a serious disease in China Evolutionarily, laccase and its substrates seem to be an adaptation of the lacquer tree for...
  • 4
  • 355
  • 0
báo cáo khoa học:

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

Báo cáo khoa học

... of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket...
  • 5
  • 573
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

Báo cáo khoa học

... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can ... in either Tarzan or a Nexusbased format A file must specify the host and parasite trees and the tip associations Optionally, the file can specify time zones or time zone ranges as well as regions ... process is repeated and nodes b and c are placed in times and Table shows the table at this point Now, d and f are candidates for time In general, the algorithm chooses the candidate whose time...
  • 10
  • 551
  • 0
Báo cáo y học:

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo khoa học

... treatment approach for OA, and agents such as GTPs could fill the gap In fact, complete deletion of the Il1b gene leads to disease exacerbation in a mouse model of OA, suggesting both a catabolic ... radiation-induced inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention ... Proc Natl Acad Sci U S A 1999, 96:4524-4529 Ahmed S, Rahman A, Hasnain A, Lalonde M, Goldberg VM, Haqqi TM: Green tea polyphenol epigallocatechin-3-gallate inhibits the IL-1β-induced activity and...
  • 2
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

Báo cáo khoa học

... whether inhaled APC can prevent or minimize primary or secondary lung damage when low tidal volumes are used for mechanical ventilation Abbreviations APC, activated protein C; ERK, extracellular-regulated ... treatment with APC was started before the initiation of injurious ventilation Therefore, it remains unknown at present whether inhaled APC would be beneficial if initiated after the lungs have ... protein C ameliorates endotoxin-induced lung injury in anaesthetised sheep Crit Care 2009, 13:R51 Kotanidou A, Loutrari H, Papadomichelakis E, Glynos C, Magkou C, Armaganidis A, Papapetropoulos A, Roussos...
  • 2
  • 391
  • 0
THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)

THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)

Tổng hợp

... to the sorcerer They have to take meal before the dead so as they are capable for taking the dead to go away Apart from introduction, inviting to take meal and ending like other chants, there are ... Whenever a funeral tray is arranged, another tray for tay of the sorcerer, or the tum is also prepared After that food trays for the whole funeral are prepared 2.3.6 Digging grave The funeral family ... take a bath before coming back home since attending a funeral relates to the death” To prevent any undesirable effects, the funeral attendants drive away all the bad and the dirty in the water...
  • 27
  • 434
  • 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tâm lý - Nghệ thuật sống

... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... what they visualised in their lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By ... thoughts and mental imprints Before sleep, these: A Recite this poem of gratitude and abundance “Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protection and...
  • 59
  • 770
  • 3
Tài liệu A New Banking System The Needful Capital for Rebuilding the Burnt District docx

Tài liệu A New Banking System The Needful Capital for Rebuilding the Burnt District docx

Quản trị kinh doanh

... furnishing an amount of loanable capital more than twelve times as great as that of all the "National" Banks in the State[C]; more than twice as great as that of all the "National" banks of the whole ... more cheaply than Massachusetts can manufacture for them Their natural advantages for manufacturing are greatly superior to those of Massachusetts They have the cheap food, coal, iron, lead, copper, ... of it, and that will have the same market value as gold The paper dollar, therefore, will have the same market value as the gold dollar, or as a dollar's worth of any other property; and no one...
  • 46
  • 356
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Báo cáo khoa học

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... the wild-type SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học

... Innovative applications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603 AAAI Press Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational ... to adapt the part-of-speech tags to facilitate this modeling strategy For example, the tag for nouns is NN as in 憞䠮䞎 ‘Iraq’ and 卣敯埚 ‘former president’ After annotation, the former is flat, but the ... some applications such as information extraction, the former segmentation is adequate, while for others like machine translation, the later finer-grained output is more preferable If the analyzer...
  • 10
  • 476
  • 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học

... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...
  • 9
  • 356
  • 0
nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)

nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)

Sinh học

... how many Forms are there? Is there a Form for a CS text? We see this issue again in AI The materialist/dualist war (it has all the characteristics thereof) is essentially part of Plato’s heritage ... necessarily part of the intersubjective domain as expanded on in chapter The meanings they carry are therefore potentially shareable How then they get their names? In the same way as “dog” and ... what is known as the semantical problem: how our names for these “private” mental states get their meaning? Related to this is the problem of how we can say that humans have mental states at all...
  • 288
  • 258
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Hóa học - Dầu khí

... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... are many research opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National...
  • 8
  • 375
  • 0
báo cáo hóa học:

báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc

Hóa học - Dầu khí

... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... are many research opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National...
  • 8
  • 494
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A New Method for Identifying the Life Parameters via Radar" pot

Báo cáo khoa học

... than the synthetic oscillatory signal Assume that the reference respiration signal x(n) has a main spectral peak fx , and the original signal is y(n) with a spectral peak f y The main spectral ... and the number of samples of the data; (4) perform inverse wavelet transformation to obtain the heartbeat signal EXPERIMENTS AND ANALYSIS There are 15 healthy volunteers who participated in the ... generated by the oscillator via a directional coupler Then it is radiated by the antenna via a circulator The oscillator operates at 10.525 GHz, and the transmission power is 30 mW Hence GaAs Gunn...
  • 8
  • 330
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

Báo cáo khoa học

... outperforms the AIC and MDL criteria in terms of detection rate (Figure 5a) Figures 5b and 5c illustrate the mean estimate and variance variations They indicate a very interesting behavior of the new ... should capture in a suitable way the jump from the last eigenvalue associated to the signal subspace and the first eigenvalue associated to the noise subspace As it was stated above, it is difficult ... Ideal shapes of (a) the discriminant functions and (b) the associated cost function, for N = estimate, the eigenvalue variation can be still used, in a different form, for obtaining N The main...
  • 12
  • 409
  • 0

Xem thêm