a new color object called mynewcolor is created for the shirt movie clip
Báo cáo hóa học: " A Robust Color Object Analysis Approach to Efficient Image Retrieval" pdf
... similar histograms can have dramatically different appearance The inaccuracy raised in the color histogram approach is caused by the total loss of spatial information of pixels in the images To attempt ... performance of CLEAR and UFM approaches for color variations and coarseness of image segmentation Color variations can be simulated by changing colors to their adjacent values for each image, and the ... 3000 image database in- troduced above To evaluate the robustness in the color variations, we apply color changes to an image (target image) in the database The modified image is then used as the...
- 15
- 352
- 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... the transgenic plants The average GUS activity was obtained from at least five independent transformants, and each assay was repeated three times RNA extraction For RNA isolation, the plant tissues ... with the known Arabidopsis DExD ⁄ H members The AtHELPS promoter::GUS and quantitative real-time PCR analysis indicated that AtHELPS is mainly expressed in the vascular tissues, such as the midrib ... RNA helicase R.-R Xu et al use Total RNA was isolated from different A thaliana seedlings with Trizol reagent (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR analysis Total RNA was...
- 11
- 786
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich ... (Bip), with its large aromatic side chain in a short intramolecular distance from the a- carbon atom, is the N-terminal amino acid and l-Proline (l-Pro) is the C-terminal amino acid The resulting...
- 10
- 490
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... used the construct pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The ... The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B and HumanD17ECPT1B mutants, the assay was performed at carnitine concentrations equal to the Km The percentage of activity ... Mutagenesis Kit (Stratagene) The primers used were DH801 (5¢-TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) and DH802 (5¢-GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGA AGAA-3¢) Using this procedure, we generated...
- 9
- 550
- 0
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; ... compilation ª 2007 FEBS N Sasai et al catalytically inactive as histone demethylases because of the amino acid changes in the catalytic domain [11,12] Several other JmjC-containing proteins are ... 5¢-TGGGCATCGAGACTATAGGG-3¢; rp49-F, 5¢-CGG ATCGATATGCTAAGCTG-3¢; and rp49-R, 5¢-GAACG CAGGCGACCGTTGGGG-3¢ Acknowledgements We would like to thank Haruki Shirato for providing the FLAG–mjmj plasmid and...
- 13
- 356
- 0
Báo cáo sinh học: " Research Article A New-Fangled FES-k -Means Clustering Algorithm for Disease Discovery and Visual Analytics" pdf
... 4(b)) For the trained data, the spatial distribution for each of the clusters is more scattered than is the spatial distribution for the clusters of the actual data Using less data points for the ... similar to the original kmeans method at a much faster rate; and (2) it provides efficient analysis of large geospatial data with implications for disease mechanism discovery From a disease mechanism ... subjects Acknowledgments Dharani Babu Shanmugam and Haricharan Padmanabana Computer Programmers assisted with program and code implementation Kara Scott for her help with the evaluation of the algorithm,...
- 15
- 411
- 0
Báo cáo hóa học: " A New MAC Protocol with Pseudo-TDMA Behavior for Supporting Quality of Service in 802.11 Wireless LANs" docx
... case of saturation analysis, it is assumed that a packet is always available for transmission For AC3 of the proposed protocol, admission control is utilized to prevent the system from overloading ... by the packet length as long as it remains larger than TxOP/2 A deviation between AC2 analysis and simulation is found in this case For better comparison, packet accumulation is used for EDCA and ... is the expected length of a nonpriority class packet, Ts is the average time that a successful transmission of a packet takes, and Tc is the average time that the channel is captured due to a...
- 9
- 428
- 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived of the study, ... β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG,...
- 16
- 178
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
... against Tax2B We thank the Takeda pharmaceutical company for providing recombinant human IL-2 We also thank Sayoko Takizawa and Chika Yamamoto for the excellent technical assistance This work was supported ... found that Tax1 and Tax2 transform a rat fibroblast cell line (Rat-1) to induce colonies in soft agar (CFSA, colony formation in soft agar), and the activity of Tax1 is greater than that of Tax2 ... and MF participated in the experimental design, data interpretation, and writing of the manuscript Acknowledgements We thank William W Hall for donating the Tax2B plasmid and the antibody against...
- 7
- 177
- 0
Báo cáo sinh học: "Mapping quantitative trait loci (QTL) in sheep. I. A new male framework linkage map and QTL for growth rate and body weight" potx
... http://www.gsejournal.org/content/41/1/34 Phase A M M AM Phase AMM* AMM Phase AM_AMM* AM_AMM AM_AMM* Phase 4b Phase 4a AM_AMM_AM_AMM AM_AM_AMM Figure Mating structure for a single sire family in the Awassi ... out the genetic marker analysis, genetic map construction, and ran the early stage analyses ML ran the early stage QTL analyses, was responsible for the data assembly, and participated in the ... weight analysis, or the growth rate analysis An additional series of analyses was performed without inclusion of the initial weight as a covariate Because of the large number of analyses, we adopted...
- 17
- 338
- 0
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx
... CA, USA) and total RNA and DNA were isolated according to the manufacturer protocols Subsequently, RNA was extracted with chloroform and precipitated with isopropyl alcohol The DNA was isolated ... of pcDNA3-Hsp65-immunized mice after the transformation of total cellular DNA suggests that some extrachromosomal plasmid DNA was maintained for at least months Southern blot analysis was done ... Izaíra T Brandão for her technical assistance This study was supported by grants from the Fundação de Amparo Pesquisa Estado de São Paulo (FAPESP, Foundation for the Support of Research in the...
- 10
- 243
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... 197 amino acids located between the Asp and His of the catalytic triad Most other subtilases have about 20 amino acids in this region and the large insertion is a special feature of TPP II and ... catalytic Asp44 and His264 are indicated by asterisks to activate the material, as previously described [15] However, all attempts so far to associate this material have failed Thus, it appears ... standard assay and the immunoreactivity was detected by Western blot analysis and quantitated as described in Materials and methods Open and filled circles indicate the activity, and open and filled bars...
- 6
- 520
- 0
Protecting New Health Facilities from Natural Disasters: Guidelines for the Promotion of Disaster Mitigation potx
... publication has been made possible through the financial support of the World Bank, the International Humanitarian Assistance Division of the Canadian International Development Agency (IHA/CIDA), the ... urricanes, floods, earthquakes, landslides and volcanic eruptions—and the devastation they inflict—are all too familiar to the countries of Latin America and the Caribbean In the last decade, natural ... earthquakes, hurricanes, and other natural phenomena Inter-American Development Bank (IDB), Facing the Challenge of Natural Disasters in Latin America and the Caribbean: An IDB Action Plan, Washington,...
- 53
- 1,155
- 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... ACGCCCACAGCAAGGAG; antisense, CTCCTTGTCG N-Glycosylation of HFE TGGGCGTGATTTTCCAT To generate the pEP7–HFEN13 0A HA mutation we used the following primer set: sense, ATGCAAGAAGACGCCAGTACCGAGGGC; antisense, ... pEP7–HFE-N11 0A HA plasmid The HFE NN130/234AA mutant was made by introducing the N23 4A mutation into the pEP7–HFE-N13 0A HA plasmid The HFE NN234/110AA mutant was made by introducing the N11 0A mutation ... antisense, GCCCTCGGTACTGGCGTCTTCTTGCAT To generate the pEP7–HFE-N23 4A HA vector we used the following primer set: sense, TACTACCCCCAGGCCATC ACCATGAAG; antisense, CTTCATGGTGATGGCCTG GGGGTAGTA Bold...
- 16
- 538
- 0
Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx
... were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢ (forward) and 5¢-GCAAACTGTTTGCAATCGATCCC-3¢ ... procedures and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ (reverse) The EcoRI ⁄ BamHI-digested PCR fragment (MscL–HA) was cloned into pC4Met [31] To construct the ... phosphatase and 4-acetamido-4¢-maleimidylstilbene-2,2¢-disulfonic acid disodium salt (AMS) were purchased from Invitrogen (Carlsbad, CA, USA) Antiserum against influenza haemagglutinin (HA) was obtained...
- 9
- 466
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P furiosus CoADR The N terminus of the CoADRs ... reduce the disulfides, and assayed as above Thiols were quantified by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the CoA and ... acting as a CoADR This is only the second demonstrated CoA reductase activity, and the first appearance of this activity in both the Archaea and in a strict anaerobe While the best known small molecular...
- 12
- 420
- 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx
... by the addition of mm EDTA and SDS ⁄ PAGE loading buffer, followed by heating in a boiling water-bath for The amount of r32 that remained after proteolysis was analyzed after SDS ⁄ PAGE of the ... and incubated overnight on a rotating machine at °C Before binding, 5% of the input solution was kept aside separately and was used as a control for comparison The proteins were analyzed in an ... substrates for HflB In addition, HflB also acts on several membrane-associated substrates, for which the mechanism of proteolysis is probably somewhat different [21] Whether kCIII would act as an...
- 6
- 453
- 0
Báo cáo " WHAT CAN HISTORY TEACH US? A Retrospective Examination of Long-Term Energy Forecasts for the United States " pptx
... (19, 47) The discipline of understanding, assessing, and managing risk is a broad arena called risk analysis This discipline is relatively young, having been developed mostly in the past half century ... Education By forcing analysts to discuss data and analysis results in a systematic way, forecasting models can facilitate communication between various stakeholders The measure of success for this ... Another example is the U.S DOE’s Energy Information Administration (EIA) Annual Energy Outlook forecast (16) This widely used forecast, based on the EIA’s latest analysis of the current data 30 Sep...
- 38
- 449
- 0
Báo cáo khoa học: PSI1 is responsible for the stearic acid enrichment that is characteristic of phosphatidylinositol in yeast pdf
... 30562–30569 Tamaki H, Shimada A, Ito Y, Ohya M, Takase J, Miyashita M, Miyagawa H, Nozaki H, Nakayama R & Kumagai H (2007) LPT1 encodes a membrane-bound O-acyltransferase involved in the acylation of ... corresponding FAMES was determined as described above The sn-2-acyl-1-lysoPI was immediately used for acyltransferase assays Acyltransferase activity assays G3PAT assays were performed as described ... contrast, PI from plants contains much more palmitic acid than stearic acid as the major (saturated) fatty acid; for example, 48% and 3%, respectively, in Arabidopsis thaliana [9] Similarly,...
- 13
- 429
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25