a multilingual web based tool to support the collaborative translation of the international classification for nursing practice icnp
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... are already in debt because of the loans they took for their initial investment costs. For the local government it is also important to have a quick solution for the issues at the farms as the shrimp farming ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ...
- 13
- 487
- 0
Native or Web app: How to Select the Right Platform for Your Enterprise Mobile Apps
... deliver an app across many devices but also take advantage of features that a purely web app cannot give them The first step is for organizations to evaluate the benefits and drawbacks of each platform ... the same time, they already had the necessary APIs on their backend to deliver data to a native template The level of backend and API support that a client can supply is a huge factor in the ... introduced automatic app updates, making for a more seamless update experience similar to HTML5 The real advantage of web apps here is forgoing any sort of approval process from app stores, therefore...
- 26
- 363
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were...
- 12
- 616
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... PAGE -based image analyses of the third quadrant Fig S3 2D IEF ⁄ SDS ⁄ PAGE -based image analyses of the fourth quadrant This supplementary material can be found in the online version of this article ... supplementary material is available: Fig S1 Application of a simple 2D IEF ⁄ SDS ⁄ PAGEbased protease proteomic approach in substrate finding 2D IEF ⁄ SDS ⁄ PAGE -based image analyses of the second quadrant...
- 20
- 506
- 0
LabelMe: a database and web-based tool for image annotation pdf
... browsing the database In the first part of the paper we describe the annotation tool and dataset and provide an evaluation of the quality of the labeling In the second part of the paper we present a ... evaluation To achieve this, we developed a web- based tool that allows easy image annotation and instant sharing of such annotations Using this annotation tool, we have collected a large dataset ... describe the details of the annotation tool and the results of the online collection effort 2.1 Goals of the LabelMe project There are a large number of publically available databases of visual objects...
- 33
- 515
- 1
Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf
... semantic relevance in the context of Web site information retrieval, and a lexical semantic map of the particular Web site The linguistic unit file contains a list of the grammatical and lexical ... version of JaBot should be able to assess the quality of its own parsing and Searching, so that it can request clarification from the user when necessary On a practical note, a semi-automatic tool for ... represents less of a problem than that of the lexical semantic map, since for a particular language the semantically empty elements will remain constant independently of the content of the Web site...
- 5
- 229
- 0
Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf
... sent to the server, which consolidates them with the stored data There is no separate “save” operation and thus a minimal risk of data loss, and as the authoritative version of all annotations ... involving human annotator judgement for each annotation As a specific realisation based on this approach, we have integrated a recently introduced machine learning -based semantic class disambiguation ... Finally, annotators can attach free-form text notes to any annotation In addition to information extraction tasks, these annotation primitives allow BRAT to be configured for use in various other...
- 6
- 335
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) were combined to form a single domain (coordination...
- 8
- 492
- 0
Báo cáo khoa học: "The "Win-Win" initiative: a global, scientifically based approach to resource sparing treatment for systemic breast cancer therapy" pdf
... costs of cancer treatment The major markets for the leading pharmaceutical industry are in the United States, Western Europe and Japan; and while these regions may be able to meet the increased ... economically sustainable cancer control strategies that could be tailored in LMCs for other forms of cancer as well Aims and hopes It is our aim to establish a scientific initiative to expand availability ... scientific initiative based on cooperation and collaboration of stakeholders; whereby markets are created or maintained for effective cancer therapies, and patients are assured access to these interventions...
- 5
- 265
- 0
cáo khoa học: " Developing a theory-based instrument to assess the impact of continuing professional development activities on clinical practice: a study protocol" doc
... with to a maximum of 10 items A minimum of 100 data entries are needed for an exploratory factor analysis (EFA) [19] Also, a minimum of 10 data entries are needed per parameter to make estimations ... provide an adequate sample size for performing both EFA and CFA for the two groups together (family physicians and specialists), as well as some of the other planned validity and reliability analyses ... 23 24 Federation of Medical Regulatory authorities of Canada: Position statement 2008 of the Federation of Medical Regulatory Authorities of Canada Graham ID, Logan J, Harrison MB, Straus SE, Tetroe...
- 6
- 501
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem -based learning when teaching ... ‘chemotherapy and radiotherapy’ are indicated in the branch of the ‘fishbone’ that shows the cause of ovarian failure, a potential cause for secondary amenorrhea/oligomenorrhea (Figure 1) The cited ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners for...
- 3
- 381
- 0
A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot
... 1999 Australian Institute of Health and Welfare (AIHW): Diabetes management and the allied health workforce: An overview of workforce mapping techniques and related data issues Canberra: AIHW; ... interrogated to meet other information requirements of the model An example of pertinent data sources for Australia that can be used to determine population health status are listed in Table The ability ... Region of Victoria Victoria, Australia: Greater Green Triangle Department of Rural Health; 2003 Queensland Health: Director General's Allied Health Recruitment and Retention Taskforce: Summary of the...
- 9
- 486
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 506
- 0
báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx
... Sample size and analysis The analysis will allow us to explain variation in both team and individual level behaviour The surveys will generate at least ordinal level quantitative data The relationships ... current practice and highlight the importance of the process of referral and testing in preparing people with dementia and their carers for a diagnosis In the area of Implementation Research we have ... rest of the UK The former will be subsequently approached for recruitment to the RCT; the latter will provide data about the generalisability of the planned trial participants Theory selection The...
- 6
- 334
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 412
- 0
báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt
... 1999 Australian Institute of Health and Welfare (AIHW): Diabetes management and the allied health workforce: An overview of workforce mapping techniques and related data issues Canberra: AIHW; ... interrogated to meet other information requirements of the model An example of pertinent data sources for Australia that can be used to determine population health status are listed in Table The ability ... Region of Victoria Victoria, Australia: Greater Green Triangle Department of Rural Health; 2003 Queensland Health: Director General's Allied Health Recruitment and Retention Taskforce: Summary of the...
- 9
- 368
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
... one attached to the headband of the CA-6000, and the other attached to the load cell, provide for alignment during the neck extension In this position the patient can exert force against the load ... thoracic spine in the cardinal planes: sagittal (AP-flexion), frontal (lateral flexion), and horizontal (rotation) The CA6000 headpiece was fitted with a laser pointer to help participants relocate ... encouraged the participant to contract into the docking station as much as possible in order to achieve an MVC The experimental protocol began by having participants locate their previously established...
- 7
- 211
- 0
Báo cáo y học: ":RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes" potx
... loci); and members of the Aquificae and Thermatogae extreme-life phylum (Thermotoga maritima, Aquifex aeolicus) Also, to assess the range of applicability of our tool, we tested the archaeum Sulfolobus ... sometimes flawed, the original annotation can provide RASTA-Bacteria with valuable hints Therefore, the tool recovers all the annotated features of the sequence, and compares the 'naïve' ORFs to the ... classification of the candidates presently requires manual analysis RASTA-Bacteria also identified numerous candidates displaying the HTH-DNA binding domains When adjacent to an unambiguous toxin...
- 14
- 335
- 0
Báo cáo y học: "GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists" ppsx
... operation Additional data file contains the results obtained by GENECODIS in the analysis of the yeast and human gene sets Additional data file provides a description of a comparative analysis of ... Biology 2007, Additional data files The following additional data are available with the online version of this article Additional data file contains an illustrative example of the GENECODIS algorithm ... between the Spanish CSIC and the Canadian NRC (CSIC-050402040003) PCS is recipient of a grant from Comunidad Autonoma de Madrid (CAM) APM acknowledges the support of the Spanish Ramón y Cajal program...
- 8
- 270
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25