... Discourse Anaphora Technical report, Bolt, Beranek, and Newman, 1978 [7] Ido Dagan and Alon Itai Automatic Acquisition of Constraints for the Resolution of Anaphora References and Syntactic Ambiguities ... [i] Chinatsu Aone, Hatte Blejer, Sharon Flank, Douglas McKee, and Sandy Shinn The Murasaki Project: Multilingual Natural Language Understanding In Proceedings of the ARPA Human Language Technology ... John Lafferty, and Salim Roukos [16] Elaine Rich and Susan LuperFoy An ArchitecDevelopment and Evaluation of a Broadture for Anaphora Resolution In Proceedings of (:',overage Probablistic Grammar...
... insect-crustacean sister-group relationship is mainly based on the comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, ... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly ... crustaceans are far from being resolved Several morphological and molecular studies have questioned the monophyly of crustaceans, and either Branchiopoda (such as Daphnia) or Malacostraca (lobster,...
... before the event My husband, David, is a bass player Back in the mid-’80s, he was playing a benefit to save Broadway theaters, which were then being demolished at an alarming rate As he was waiting ... manager insisted on it As a supervisor, Ryan now had to give in-person reports to top management on a regular basis Every time his manager asked for an advance look at Ryan’s presentation, Ryan ... early 1970s to embark upon a career as an actor and singer To learn my craft and prepare for auditions, I studied with the best acting and voice teachers in the business They reassured me that...
... and examination, and all the biochemical, radiological and cardiological investigations are readily available in all clinical settings This means that, with practice, both scores can be gauged ... not actually utilized and white cell count, and all had electrocardiography performed A chest radiograph was obtained in 69.7 per cent of patients Scores were awarded according to Tables I and ... the porta hepatis Discussion As far as we are aware, this is the first case of classical hepatocellular carcinoma occurring in a cirrhotic liver A 39-year-old male Caucasian cabinet-maker presented...
... Miroslav Melichar, and Martin Rajman 2005 A Framework for Rapid Multimodal Application Design In V´ clav Matouˇek, Pavel Mautner, a s and Tom´ s Pavelka, editors, Proceedings of the 8th a International ... the system in the form of sets of semantic pairs A semantic pair (SP) is a qualified piece of information that the dia50 logue system is able to understand For example, asystem could understand ... both in the data analysis, and in how the tutorials are written and structured The actual experiment consists of two parts in Analysis of elicited language data The data collected with Archivus through...
... (DHHS) a Administration for Children and Families (ACF) b Administration on Aging (AOA) c Agency for Healthcare Research and Quality (AHRQ) d Agency for Toxic Substances and Disease Registry (ATSDR) ... Occupational Safety and Health Administration (OSHA) sets and enforces health standards for workplace conditions B Describe the role of National Institute for Occupational Safety and Health (NIOSH) ... suggestions have been offered by health organizations, agencies and health educators In 1994 the American Public Health Association (APHA) and the American Medical Association (AMA) established The...
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes and 2, ... RP-HPLC and stored at )70 °C Materials and methods Enzymatic assays Biological materials Tissue Human skin and placenta were obtained from discarded biopsy material or surgical specimens, or after...
... support for clarification and correction subdialogues The Duke system (Smith and Hipp, 1994) uses a more general model based on a reasoning system, but allows only a limited vocabulary and grammar and ... OKAY NOW ADD STATE THE LAST TRAIN AND GO FROM ALBANY TO O_O'S HYP': OKAY NOW I TAKE THE LAST TRAIN IN GO FROM ALBANY TO IS REF: OKAY NOW LET'S TAKE THE LAST TRAIN AND GO FROM ALBANY TO MILWAUKEE ... THE LAST TRAIN AND GO FROM ALBANYTO O O'S Okay Now let's take the last train and go from Albany to Milwaukee No What city are you trying to have the engine at Montreal arrive at, if I caught...
... a helices, anda separation in the contact surface of membraneand protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative estimation of the thickness and ... of K+-activated phosphatase at 0.1 MPa for BIPM and FITC was taken as 100% Based on three independent experiments, the means and standard deviations are shown by error bars 114 M Kato et al (Eur ... 40 Tsuda, T., Kaya, S., Yokoyama, T., Hayashi, Y & Taniguchi, K (1998) ATP and acetyl phosphate induces molecular events near the ATP binding site and the membrane domain of Na+, K+-ATPase: The...
... intentionally left blank TurboCoach A Powerful Systemfor Achieving Breakthrough Career Success Brian Tracy and Campbell Fraser American Management Association New York • Atlanta • Brussels • Chicago • Mexico ... corporations, professional associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management Association, 1601 Broadway, New York, NY 10019 ... priorities, and goals; analyze yourself and identify your personal strengths; delegate, outsource, and eliminate tasks and activities so you can concentrate on the things that are most valuable to you and...
... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... commercially available enzyme linked immunosorbent assays (ELISAs; Cayman Chemical, San Diego CA USA) Nitrite assay Cell culture medium was assayed for NO2- by the Griess assay as described [8] Samples ... (ImageQuant™, Molecular Dynamics) Within each sample, the density of each apoptosis-associated mRNA band was normalized to the sum of the L32 + GAPDH bands Eicosanoid assays PGE2 and LTB4 were measured in...
... event-based reputation system can dynamically collect event information, determine the plausibility and timeliness of an event, and broadcast accurate and reliable traffic warning messages in most VANET ... on Availability, Reliability and Security (ARES ’07), pp 422–431, Pheonix, Ariz, USA, April 2007 [11] M Raya, P Papadimitratos, I Aad, D Jungels, and J.P Hubaux, “Eviction of misbehaving and faulty ... Fall and K Varadhan, “The ns-2 manual,” the VINT Project, April 2002, http://www.isi.edu/nsnam/ns/doc [20] A Mahajan, N Potnis, K Gopalan, andA I A Wang, “Evaluation of mobility models for vehicular...
... Other approaches are forced to use a smaller language model in the first pass and rescore with a larger language model R Amaral et al Table 2: APP impact on speech recognition Segment boundary Manual ... specially considering the lack of video information in our approach R Amaral et al Table 4: Topic indexation results APP ASR Manual Manual Manual Auto Manual Auto w/o conf Auto w/conf Auto w/conf ... Multilingual Spoken Document Retrieval (MSDR ’03), pp 25– 30, Hong Kong, April 2003 [26] C Martins, A Texeira, and J Neto, “Dynamic vocabulary adaptation fora daily and real-time broadcast news transcription...
... mg!l-! IBA In this mass treatment combination, BAP was more effective in promoting shoot proliferation than KIN was At the elongation stage, the addition of AC, GA BAP (0.05 mg , ) I’ and IBA (0.05 ... rooting was 82% compared to 60% observed was White medium at the same IBA concentration Rooting was also stimulated by an IBA concentration up to 1.0 mg!l-1 As the concentration of IBA increased ... Results was Optimum shoot multiplication rate was obtained on the medium containing 0.5 l’ mg BAP and 0.05 mg IBA (Table II) I’ A rate of shoots per explant was developed within 30 d When KIN was used,...
... angiogenesis.dkfz.de/oncoexpress/software/sumo/) was used for statistical analysis, two-class t-tests and GOanalysis Pathway analysis was performed based on information available on cellular signalling processes from a curated database ... microarray analysis was also performed for RNA isolated from cells incubated for the same time period (24 h) under normoxic conditions For bioinformatical-analysis a step-wise approach was applied: ... of carbonic anhydrase IX (CA9) (A) and lysyl oxidase (LOX) (B) in head and neck squamous cell carcinoma cells HNO97 under normoxia and hypoxia (2% O2) using the enzymatic GOX/ CAT systemand a...
... each performance target anda similar system is used for the action program The performance target team leader and those named as responsible for the action program are the team for achieving ... market, transferring business management ideas across the organization and having a common management approach inculcated in all levels of its staff At its Crotonville management training facility ... people’ for the organization and lead to an action plan for recruiting and retaining them Some years ago I was working with a major airline in reviewing its overall strategy It had a list of six main...
... sequencing and microsatellite analysis are accurate, but are more expensive, take longer to do, and are mainly available at commercial laboratories Also, DNA sequencing and microsatellite analysis is often ... Santa Cruz, Santa Cruz, CA Santa Cruz, Santa Cruz, CA Polyclonal Antibodies Anti-MSH2 (Ab-3) Pc57 Calbiochem, San Diego, CA Anti-MLH1 (Ab-2) Pc56 Calbiochem, San Diego, CA Rabbit anti-MSH2 A3 00-02 0A ... BMB, NA, AAA and JZF conceived the idea, designed and supervised the study, and participated in data analysis and writing of the manuscript; MP, CS and ZJA provided genetic counseling All authors...
... vitro MY and HS performed structure modeling analyses HY and MK examined viral genome sequences NI and TM analyzed the data and wrote the paper All authors read and approved the final manuscript ... Iida A, Hirata T, Hasegawa M, Yuasa T, Miyazawa M, Takahashi Y, Yasunami M, Kimura A, O’Connor DH, Watkins DI, Nagai Y: Cytotoxic T lymphocyte-based control of simian immunodeficiency virus Inagaki ... equally at the 205th aa in Gag; 340 V/M, V and M were detected equally at the 340th aa in Gag a presenting a structural constraint for functional interaction between SIV CA NTD and CTD HIV and...
... sequence reversing each entryand appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) and an MS/MS tolerance at 0.5 Da and either full ... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... sequence database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared...