a life cycle assessment on enzyme bleaching of wood pulp icpet canada
Solid Waste Management and Greenhouse Gases A Life-Cycle Assessment of Emissions and Sinks potx
... significant NA: Not applicable, or in the case of composting of paper, not analyzed a MTCE/ton: Metric tons of carbon equivalent per short ton of material Material tonnages are on an as-managed ... determined that the best way to conduct such a comparative analysis is a streamlined application of a life- cycle assessment (LCA) A full LCA is an analytical framework for understanding the material inputs, ... This page intentionally left blank 16 RAW MATERIALS ACQUISITION AND MANUFACTURING The GHG emissions associated with raw materials acquisition and manufacturing are a key element of a life- cycle...
- 170
- 1,000
- 0
Life cycle assessment of 50 kWp grid connected solar photovoltaic (SPV) system in India
... India His area of interest is solar air heater, life cycle assessment and heat transfer He has been published more than 20 papers in International / National Journals E-mail address: varun7go@gmail.com ... modules are expected to have longer lifetime according to the manufacturer guarantee India does not have yet extensive life- cycle data base available for general use Consequently, some data are available ... E., Alsema E, Van Engelenburg B Usinf, Life cycle assessments for the environmental evaluation of greenhouse gas mitigation options Energy Conversion and Management 1996;37:831-6 [4] Alsema EA,...
- 8
- 506
- 0
Life cycle assessment (LCA) of an energy recovery plant in the olive oil industries
... quantities each year due to different harvests of the trees The best advantages are the limited costs of pomace as a raw material and the availability of a mature technology for biomass exploitation [34] ... screening A secondary screening is performed on the undersize fraction and allows the separation of a fraction larger than 60mm and a finer fraction which is sent for biological treatment The production ... impact assessment aims to quantify the relative importance of all environmental burdens contained in an LCI and at aggregating them to a single indicator, GWP100 On the types and quantities of...
- 12
- 647
- 1
Global Guidance PrinciPles for life cycle assessment databases: A Basis for Greener Processes and Products ppt
... oficina analisaram as diferentes fontes adicionais de dados tais como dados geoespaciais, dados de tabelas de entradas e saớdas econụmicas nacionais e contabilidade ambiental, dados sobre indicadores ... they talk about LCA data and databases The glossary uses the International Organization for Standardization (ISO) termin-ology, as far as it is available, and provides additional explanation or ... International Panel on Climate Change ISIC International Standard Industrial Classification ISO International Organization for Standardization IT information technology JEMAI Japan Environmental Management...
- 160
- 526
- 0
Screening environmental life cycle assessment of printed,web based and tablet e-paper newspaper ppt
... from: Hard coal, Germany 1996, GaBi data Natural gas, Germany 1996, GaBi data GaBi Light fuel oil, Germany 1996, GaBi data GaBi Wood, EU 1996, BUWAL data in GaBi database Landfill GaBi BUWAL Swiss ... Data on avoided thermal energy from: Hard coal, Germany 1996, GaBi data Natural gas, Germany 1996, GaBi data GaBi Light fuel oil, Germany 1996, GaBi data GaBi Wood, EU 1996, BUWAL data in GaBi ... normally means some sort of marginal data 12 Goal and scope definition Inventory analysis Interpretation Impact assessment Figure A Life Cycle Assessment consists of four phases 1.2.2 Allocation and...
- 104
- 1,067
- 2
DETERMINANTS OF CREDIT TO HOUSEHOLDS IN A LIFE-CYCLE MODEL pdf
... herein are those of the authors and not necessarily those of the National Bank of Poland Michal Rubaszek at National Bank of Poland, 00-919 Warszawa, ul Świętokrzyska 11/21, Poland and Warsaw School ... (ECB) and Katerina Šmídková (Czech National Bank) are workstream coordinators Xavier Freixas (Universitat Pompeu Fabra) acts as external consultant and Angela Maddaloni (ECB) as Secretary The refereeing ... factor and E0 is the expectation operator conditional on information available at the beginning of period The life of individuals consists of two parts.1 During initial J1 years they participate...
- 43
- 1,098
- 0
Life cycle assessment of Bioethanol
... định Life cycle assessment of Bioethanol PHAN THỊ DẠ THẢO Life cycle assessment of Bioethanol PHAN THỊ DẠ THẢO Life cycle assessment of Bioethanol PHAN THỊ DẠ THẢO * Sản xuất ethanol Life cycle assessment ... 2- LIFE CYCLE ASSESSMENT 2.1- Khái niệm: LCA - life cycle assessment, hay gọi life cycle analysis, life cycle inventory, ecobalance, cradle-to-grave-analysis, well-to-wheel analysis dustto-dust ... bao gồm: Carbon dioxide (CO2), Methane (CH4), Nitrous oxide (N2O), Chlorofluorocarbons (CFC-12), Hydro fluorocarbons (HFC-13 4a) , The CO2-equivalent of all of the contaminants above Carbon monoxide...
- 17
- 713
- 2
Life cycle assessment of carbon and energy balances in jatropha production systems of burkina faso
... speciessuchasVittelariaparadoxa,Feidherbiaalbida,Adansoniadigitata,Tamarindus indica, Lannea microcarpa, Azadichta indica,and Bombax costatum (Thiombiano and Kampmann 2010). The Sudanien zone (South Sudan) ... Ziziphus mauritiana, Lannea microcarpa,andAzadichtaindicaarethe mostcommonintheagroforestryparkland systems.IntheSudanoͲSahelianAEZ(NorthSudan)annualrainfallrangesfrom700to ... theirpropertyorforthetraditionalproduction of soap. (2)Afforestationsystem on marginalland Jatrophacurcasplanted on landabandonedfromagriculturalactivities(seeAppendix 9.2 for picture) because...
- 183
- 564
- 0
A cross culture study on using gestures of vietnamese and american people
... communication a Paralanguage Paralanguage refers to the nonverbal elements of communication used to modify meaning and convey emotion Paralanguage may be expressed consciously or unconsciously, and ... seen as communicating an act of attraction Touch as an act of body language is something that occurs in many settings across the board As always, body language acts of all types are dependent on ... have originated as a gesture of peace by demonstrating that the hand holds no weapon Hand-clapping (applause) Applause (Latin applause, to strike upon, clap) is primarily the expression of approval...
- 76
- 1,354
- 10
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran conformations of amino acid residues in protein structures J Mol Biol 264, 191198 46 Jia Z, Vandonselaar M, Quali JW ... Borchert TV, Abagyan R, Jaenicke R & Wierenga RK (1994) Design, creation, and characterization of a stable, monomeric triosephosphate isomerase Proc Natl Acad Sci USA 91, 15151518 15 Casal JI, Ahern...
- 15
- 635
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... molecular dynamics (SMD) simulations have shown that for I27 rupture of a pair of hydrogen bonds in the A and B b-strands near the amino terminus of the protein domain causes an initial extension of ... dependency of a reaction can easily be obtained, providing detailed information on the transition state of interest Through continued examination and the development and refinement of theoretical models ... separately, in the constant force SMD simulations The model preparation and data analysis were done with VMD[84] and MD simulation with NAMD.[85] During the ns equilibration the protein is reasonably...
- 12
- 553
- 0
báo cáo hóa học:" Multi-modal-analgesia for pain management after Hallux Valgus surgery: a prospective randomised study on the effect of ankle block" doc
... side-stream gas analysis Peak endtidal and mean end-tidal sevoflurane concentrations were recorded and used for evaluation of need for anaesthesia Immediately after surgery anaesthesia was discontinued ... qualitative systematic review Acta Anaesthesiol Scand 1998, 42:71?9 Holmer Pettersson P, Owall A, Jakobsson J: Early bioavailability of paracetamol after oral or intravenous administration Acta ... 0.01 ANOVA HV Hallux Valgus Et Sevo end tidal concentration of sevoflurane OAAS Observer Assessment of Alertness Scale (5 awake, asleep not responding to noxious stimulation) Page of (page number...
- 5
- 601
- 0
Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx
... Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication of ... over that of using a single layer of APS After deposition of the source and drain electrodes, the top gate was fabricated on a 500-nm-thick APS layer on nanotubes and source and drain electrodes ... to fabricate a nanotube device on a cover glass and to investigate its applications Regarding the fabrication process of the nanotube FET sensor, chemical vapor deposition (CVD) method has been...
- 6
- 346
- 0
current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010
... result of caring, assistance and treatment management activities for the AIDS patients Table 3.26 Result of consultation, assistance activities for the AIDS patients Research place Hanoi Nghe An ... treatment to 18,3% after month of treatment and 6,9% after 12 months When making a comparison between before ARB treatment and after months, between after months and after 12 months of ARV treatment, ... defenced at the State Council of thesis mark in Central Institute of Hygiene and Epidemiology at , date month year The thesis can be serached at: National library The library of National Institute of...
- 27
- 364
- 0
Báo cáo khoa học: "Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Productivity in Mice" pdf
... vitamin A are mediated through its metabolites, which may play a role in lymphocytes proliferation, signaling and activation [29] It is considered that treatment with a combination of CLA and vitamin ... had lower immunoglobulin concentrations than those of all the 0.5% CLA groups Even serum IgG concentration in 1.5% CLA group was decreased compare to that of control Over-dosage of CLA may affect ... 4) All of the treated groups had a significant increase compared to the control group (p
- 6
- 344
- 0
Báo cáo toán học: "A short proof, based on mixed volumes, of Liggett’s theorem on the convolution of ultra-logconcave sequences" docx
... representation Let a = (a0 , , am ) be a real sequence, satisfying the Newton inequalities (2) of order m I.e we dropped the condition of nonnegativity from the definition of ultra-logconcavity It ... reading of the original version of this paper Their corrections and suggestions are reflected in the current version I would like to thank the U.S DOE for financial support through Los Alamos National ... Burago and V A Zalgaller, Geometric Inequalities, Springer-Verlag, 1988 [3] H Davenport and G Polya, On the products of two power series, Canad J Math 1(1949), 1-5 [4] L Gurvits, On multivariate...
- 5
- 311
- 0
Báo cáo toán hoc:"A New Lower Bound on the Density of Vertex Identifying Codes for the Infinit" doc
... Karpovsky, Chakrabarty, and Levitin [6] considered the 6-regular, 4-regular, and 3-regular infinite grids that come from the tilings of the plane by equilateral triangles, squares, and regular hexagons ... Hexagonal Grid, SIAM J Discrete Math., 13 (2000), pp 492–504 [4] I Honkala, T Laihonen, On identification in the triangular grid J Combin Theory Ser B 91 (2004), no 1, 67–86 [5] I Honkala, T Laihonen, ... k-regular graph has density at least 1/(1 + k/2) When we study the proof of Proposition 1, it is natural to look for “slack”, i.e., vertices that have charge greater than 2/5 after the discharging...
- 16
- 309
- 0
Product Design for the Environment: A Life Cycle Approach - Chapter 1 ppt
... Scheme of strategy evaluation matrices Analysis and decomposition of a conventional system Application of a strategy evaluation matrix and mapping of the system: Reuse Conventional system: Matrices ... Evaluate Environmental Performance of Products 3.2.4 Life Cycle Simulation Life Cycle Management Summary References Life Cycle Assessment 4.1 Environmental Analysis and Evaluation of the Life Cycle ... trademarks, and are used only for identification and explanation without intent to infringe Library of Congress Cataloging-in-Publication Data Catalog record is available from the Library of Congress...
- 63
- 611
- 1
Product Design for the Environment: A Life Cycle Approach - Chapter 2 potx
... type of environmental impact, it is necessary to apply evaluation processes that elaborate the quantitative data in relation to some factors: • The scale of the evaluation (local, regional, global) ... flows of exchange with the ecosphere, the main factors of life cycle impact can be summarized as: • Consumption of material resources and saturation of waste disposal sites • Consumption of energy ... depletion of mineral and fossil fuel reserves as a result of their extraction and transformation into construction materials and energy) • Pollution—All the various phenomena of emission and waste,...
- 24
- 360
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25