a historical account with emphasis on differentiating it from other diseases with organized deposits
Tài liệu PHASETRAMSITIOMS A Brief Account with Modern Applications doc
... PHASETRAMSITIOMS A Brief Account with Modern Applications This page intentionally left blank PHASETRAMSITIOMS A Brief Account with Modern Applications Moshe Gitterrnan Vivian (Hairn) Halpern Bar-Ilan ... temperature a phase transition does not appear in a one-dimensional system but such a transition does occur in two dimensions A qualitative explanation of the onset of a phase transition as an order–disorder ... second order phase transitions, with which are associated many unusual properties 1.2 Appearance of a Second Order Phase Transition Before proceeding to a detailed mathematical analysis, it is worthwhile...
- 145
- 1,038
- 0
Tài liệu THE RAILROAD QUESTION A HISTORICAL AND PRACTICAL TREATISE ON RAILROADS, AND REMEDIES FOR THEIR ABUSES docx
... iron and steel, and above all the fact that in our climate canal carriage is unavailable during five months of the year, gave the railroads a decided advantage in their competition with canal transportation ... Ionia with Sardes in Lydia, with Babylon and with the royal city of Susa; they led from Syria into Mesopotamia, from Ecbatana to Persepolis, from Armenia into Southern Persia, and thence to Bactria ... from the head of Lake Champlain to its junction with the Erie Canal at Waterford; the Oswego Canal, from Lake Ontario at the city of Oswego to the Erie Canal at Syracuse; the Black River Canal,...
- 426
- 470
- 0
A REVIEW OF MILK PRODUCTION IN INDIA WITH PARTICULAR EMPHASIS ON SMALL-SCALE PRODUCERS pdf
... 2000 2001 12 Analysis of the Dairy Sector in Haryana 3.2 Natural Conditions and Farm Structure in Haryana Natural Conditions Temperature Haryana experiences moderate and high temperatures throughout ... this farm type is that buffaloes usually only lactate every other year 4-Cow Farm (IN4) Location: A farm in a rural area, close to a larger town, with 3.7 irrigated land Activities: The farm keeps ... year with only slight variation between seasons Rainfall Summer is the rainy season in Haryana However, the state has a good irrigation system, which makes farmers relatively independent of rainfall...
- 61
- 425
- 0
Báo cáo khoa học: "Characteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year study" pdf
... average age at onset was 6.1 ± 4.1 years (range 0.5–22, n = 202) The detailed information on the age at onset or Page of (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, ... limits in the evaluation of clinical signs Additionally, owners probably not contact a veterinarian, if a horse has only mild signs such as pruritus without skin lesions Both Icelandic horses and ... between the qualitative variables with non-parametric distribution were evaluated by Fisher's exact test The t test was used when the differences between the quantitative variables with parametric...
- 6
- 363
- 0
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... Americans went on within a century to succeed the English as the world’s pre-eminent national economy Larry Neal, The Rise of Financial Capitalism: International Capital Markets in the Age of Reason ... discussion of various rationales or explanations of continuing importance of agency ratings in U.S and global capital markets 1.Origins John Moody is credited with initiating agency bond ratings, ... in itself indicates that agency credit ratings are hardly an integral part of capital market history It also raises several questions Why did credit rating agencies first appear when (1909) and...
- 30
- 611
- 1
Tài liệu An Account of the Foxglove and some of its Medical Uses With Practical Remarks on Dropsy and Other Diseases doc
... considerable degree of expectoration, and a paucity of urine She had been blooded, taken soap, assaf and squill, afterwards assaf and ammon with acet scillit.: but all her complaints increasing, a ... Henry Warren, Æt 60 This man had a general anasarca and ascites, and was moreover so asthmatic, that, neither being able to sit in a chair nor lie in bed, he was obliged constantly to walk about, ... respiration, and a sense of fulness about his stomach; these complaints increasing, his abdomen gradually enlarged, and a fluctuation in it became perceptible He had no anasarca, no appearance...
- 86
- 598
- 0
Tài liệu Insight into Alternative Approaches for Control of Avian Influenza in Poultry, with Emphasis on Highly Pathogenic H5N1 doc
... plants and/or its derivatives have been investigated In addition to its antiviral activity, these extracts often have anti-bacterial, anti-fungal, anti-inflammatory, anti-oxidant and/or analgesic ... Pennsylvania, USA in early 1980s, one of control proposals was the use of amantadine as a therapeutic and/or prophylactic approach Under experimental condition, amantadine given in drinking water was ... Assessment of national strategies for control of high-pathogenicity avian influenza and low-pathogenicity notifiable avian influenza in poultry, with emphasis on vaccines and vaccination Rev Sci...
- 30
- 545
- 0
Tài liệu Overview on Poultry Sector and HPAI Situation for Indonesia with Special Emphasis on the Island of Java - Background Paper doc
... stations: e g Soekarno Hatta, Jakarta; Tanjung Perak; Makasar; Ngurah Rai; Tanjung Emas; Tenau; Syamsudin Noor; Sepinggan; Tarakan; Malahayati (Aceh); Tanjung Balai Asahan; Entikong; Ternate; Ambon; ... (12.2 million hectares), and Malaysia (7.9 million hectares) The national capital of Indonesia is Jakarta, a metropolitan area with a population of over million; Greater Metropolitan Jakarta includes ... urban areas in the city of Jakarta, Surabaya, Medan, Bandung and Makassar Africa/Indonesia Team Working Paper Table Percentage of Urban Population and their Respective Growth % of Urban Population...
- 77
- 949
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... 2006 The Authors Journal compilation ª 2006 FEBS 2167 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were...
- 11
- 548
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... mitochondria J Biol Chem, 272, 21104– 21112 Yamada A, Yamamoto T, Yoshimura Y, Gouda S, Kawashima S, Yamazaki N, Yamashita K, Kataoka M, Nagata T, Terada H et al (2009) Ca(2+)-induced permeability ... we concluded that the ANT of our mitochondrial preparations of A franciscana embryos is fully functional ANT of A franciscana is refractory to inhibition by BKA As mentioned above, BKA was without ... without an effect on Ca2+ uptake rate and capacity in Artemia mitochondria Atypical Artemia ANT Fig Effect of Ca2+ uptake on light scattering in mitochondria isolated from the liver of X laevis (A) ...
- 15
- 505
- 0
The European Union’s Framework Program 7 (with an emphasis on ICT) ppt
... definition, organisation and management of joint or common initiatives together of course with management of the action ● Coordination of activities with relevant National and Regional actions ... Program (with an emphasis on ICT) 1.4.7 Who can participate? The program is open for participation by any natural or legal entity in a Member State or an Associated State A legal entity can be a ... Consortium Management, Dissemination and Training are also available when permitted in that Funding Model However Demonstration activities are raised to 50% across the board A transitionary derogation...
- 285
- 1,015
- 0
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc
... churchowned primary health care facilities in Dar Es Salaam and other Tanzanian coast regions East Afr Med J 2001, 78(10):510-514 Ratanawijitrasin S, Soumerai SB, Weerasuriya K: Do national medicinal drug ... health worker's perceived and actual needs change with time, place and clinical caseload Needs vary also according to availability of diagnostic, treatment and referral facilities And they may ... clinical problems: pneumonia, diarrhoea with dehydration, sepsis, severe malnutrition and hypoglycaemia Three fourths of the doctors had inadequate knowledge in at least one area, compared with...
- 13
- 558
- 0
Báo cáo hóa học: " Precoding and Transmitter-Side processing techniques for multiuser MIMO OFDM systems with special emphasis on the PAPR problem" pdf
... evaluation in the paper “Power amplifier linearization technique with IQ imbalance and crosstalk compensation for broadband MIMO OFDM transmitters“ by Fernando Gregorio, Juan E Cousseau, Stefan ... OFDM Adapting the spatial filter is also considered in “Peak-to-Average-Power-Ratio (PAPR) Reduction in WiMAX and OFDM /A Systems“ by Seyran Khademi, Thomas Svantesson, Mats Viberg, and T Eriksson ... Werner, Taneli Riihonen, and Risto Wichman where a stochastic control algorithm is devised for a novel joint crosstalk, IQ imbalance and nonlinear amplifier response compensation of a MIMO OFDM transmitter...
- 2
- 349
- 0
Báo cáo hóa học: " Micro-nano hybrid structures with manipulated wettability using a two-step silicon etching on a large area" ppt
... and surface characterizations using FE-SEM and participated in draft writing SJS conducted practical MNHS fabrication, surface wettability characterizations, and graphical information creation ... Contact angle measurement All measurements of surface contact angle were conducted using KSV CAM-200 (KSV Ins.) The value of contact angle on each fabricated substrate was automatically calculated ... PR removal Pillar Asher Pillar Acetone Cavity Asher Cavity a Micro-pattern Contact angle Acetone SEM images displayed not match practical sizes, but present geometrical structures performance by...
- 10
- 319
- 0
báo cáo hóa học:" Research Article A Note on a Beam Equation with Nonlinear Boundary Conditions" doc
... equations with functional boundary os, conditions,” Journal of Mathematical Analysis and Applications, vol 340, no 1, pp 239–251, 2008 18 A Cabada, R L Pouso, and F M Minh´ “Extremal solutions ... thus M a, b b t∈ a, b b k t, s ds a b k a, s ds a a a a2 − 3s2 3.3 6s ds Since k is a nondecreasing function of t, we have max 0
- 14
- 276
- 0
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_1 pot
... obtain quantitative information about other ranges and conditions, with differing operations and parameters As a result, this test is usually classified as a ‘ranking test’ ‘Ranking’ – Non-Machining ... compact processing – the latter, giving a controlled ‘density’10 across and along the part, makes it particularly ‘ideal’ for any secondary machining machinability trials Boring operations can also ... NB Although the ‘Rapid facing test’ quickly assesses one particular test criterion that a machinability rating can be based upon, it suffers from a number of limitations Firstly, the material’s...
- 9
- 334
- 0
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_2 docx
... passes 281 282 Chapter tions For a practical machinability trial employing a ‘Latin square’ , it uses a two-way ANOVA13 table, with a limited amount of ‘degrees of freedom’ , typically: feedrate, ... be made in the surface integrity section What is apparent from using the AWT technique is that on a very short timescale, considerable data can be generated and applied research assessments can ... discussion The facing-off secondary machining operation meant that after 10 facing passes, a pre-programmed ‘optional stop’ can then be applied, to allow both tool flank wear and compact surface...
- 9
- 284
- 0
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_4 pot
... the fact that each axis is positioned at 90° with respect to each other, often situated on top of another axis For example, on a typical 3-axis vertical machining centre, the ‘Y-axis’ sits on top ... with potential chatter conditions and the application of the ‘stability lobe diagram’ [Source: Degarmo, Black & Kosher, 2003] Machinability and Surface Integrity either entirely eliminating it, ... compositions ranging from ductile metals (i.e aluminium and steel grades) and brittle materials (i.e cast irons and brasses, etc.), together with some non-metallics (plastics, etc.) and composite...
- 9
- 286
- 0
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_5 pdf
... peaks and valleys on the surface trace The most confusing argument concerning the use of an Ra value alone, is that its numerical value is not only meaningless, but it can have catastrophic consequences ... ‘Internationally’ , there are a few provi- 53 ‘Cross-honing’ , uses either: (fine) Abrasives/CBN/Diamond – ‘stones’ , that are fitted into a ‘honing head’ which then rotates and oscillates within a ... two-dimensional surface parameters can be classified into three distinct groupings and just some of these parameters are: Amplitude parameters (Ra, Rq, Wa, Wq, Pa, Pq)51 – with Ra52 being universally...
- 9
- 314
- 0
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_7 ppt
... disparate and cannot be utilised With calculated data that is reasonably close to either –1, or +1, a ‘regression line’ (i.e using linear regression) can be calculated based upon the general straightline ... surface texture and its proportional bandwidth, with similar values with respect to its roundness These ‘machinability and metrology trends’ allow examination of both the bandwidth variability and ... enabling them to be used as a means of surface characterisation The notation a is the allocated weighting for the profile ordinates measured from the lowest valley and above, with notation...
- 9
- 315
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25