a haplotype analysis system for genes discovery of common diseases
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... for orthopaedic and manual diagnostics, here for reasons of efficiency and usability of the system in routine occupational medical examinations, the measures are chosen according to the situation ... out as additional information about the sacroiliac joint and sensitivity tests on the various dermatomes for Page of 10 (page number not for citation purposes) Journal of Occupational Medicine and...
- 10
- 575
- 0
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... we wanted to revalidate the locomotor monitoring system that our research group designed and validated several years ago The new apparatus allows easier recording of animals by means of a battery ... the aid of a mechanical object with standardized movement Structure of the apparatus The apparatus was designed for the simultaneous monitoring and recording of 12 individually housed animals Each ... PA, Love S: Doppler shift radar monitoring of activity of rats in a behavioural test situation Physiol Behav 1985, 35:85-87 Parreno A, Saraza ML, Subero C: A new stabilimeter for small laboratory...
- 8
- 586
- 0
Example 43, 2 x 2-Cavity Stack Mold with a Hot-Runner System for Runnerless Molding of Polystyrene Container Lids Using Direct Edge Gating
... being displaced, would leave gate marks and mean a large percentage of wasted material in the runner Internal gating would be a possibility with a threeplate mold and a break-away pinpoint gate However, ... remaining components, material no 1.2312 is employed because of its better machinability The mold clamping plates are made of material no 1.1730; the wear plates are made of material no 1.2162 and ... bottom surface of the bumper fascia are formed by core pins (18) They are operated by hydraulic wedge gate (19) located along the adaptor plate area of the mold Runner System/ Gating The part is filled...
- 22
- 425
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... include: Friends of the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society,...
- 88
- 581
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase of thermoresistance of cells Thus, SA may ... Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a subsequent...
- 8
- 470
- 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
- 5
- 347
- 0
Báo cáo khoa học: "a System for Cross-fertilization of Computational Lexicons" pdf
... Marinelli, and Antonio Zampolli 2003 ItalWordNet: Building a Large Semantic Database for the Automatic Treatment of Italian In Antonio Zampolli, Nicoletta Calzolari, and Laura Cignoni, editors, Computational ... extension and adaptation to computational lexicons of XFlow, a framework for the management of document workflows (DW, Marchetti et al., 2005) A DW can be seen as a process of cooperative authoring ... document and finally it will send the modified document to the server 5.2 Adriana Roventini, Antonietta Alonge, Francesca Bertagna, Nicoletta Calzolari, Christian Girardi, Bernardo Magnini, Rita Marinelli,...
- 4
- 416
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... frontal left lobes of Alpha and Gamma2 band and central lobes of the Alpha band Alterations in the Alpha band are also expected since they are generally associated with problems in attention and ... for further analysis of our results from univariate analysis In Table we analyze the spectral biomarkers of the two groups for Task Specifically, the table presents the average and the standard ... years analyzed in [32] have also shown an increase in theta and alpha power When considering the mathematical subtraction Task the most significant bands (Table 2) are Theta, Beta and Gamma2...
- 14
- 454
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment of the ... resonance frequencies of a hip stemfemur system: a finite element analysis In Proceedings of the International seminar Prediction and evaluation of total hip replacement performance: can we plan ... 30:278-284 Lannocca M, Varini E, Cappello A, Cristofolini L, Bialoblocka E: Intraoperative evaluation of cementless hip implant stability: A prototype device based on vibration analysis Med Eng...
- 10
- 542
- 0
Báo cáo hóa học: " Research Article A Prototype System for Selective Dissemination of Broadcast News in European Portuguese" potx
... Other approaches are forced to use a smaller language model in the first pass and rescore with a larger language model R Amaral et al Table 2: APP impact on speech recognition Segment boundary Manual ... has a good real-time performance, although the results for European Portuguese are not yet at the level of the ones for languages like English, where much larger amounts of training data are available ... and S A Della Pietra, A maximum entropy approach to natural language processing,” Computational Linguistics, vol 22, no 1, pp 39–71, 1996 [15] S Matsoukas, R Prasad, S Laxminarayan, B Xiang,...
- 11
- 429
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery of didanosine for site ... myristate loaded liposomes J Pharmazie 2005, 60:840-843 37 Uma Maheswari K, Ramachandran T, Rajaji D: Interaction of cisplatin with planar model bilayers - Dose dependent change in electrical characteristics...
- 9
- 359
- 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... Mukai T, Nakano K, Kagawa M, Chen J, Mori Y, Sunagawa T, Kawanishi K, Sashihara J, Hata A, Zou P, Kosuge H, Yamanishi K: Comparison of the complete DNA sequences of human herpesvirus variants A ... Genomic organization of arrayed viruses Genomic organization of arrayed viruses Locations and direction of transcription of each open reading frame of the arrayed viral genomes are shown Red arrows ... and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then obtained A ratio...
- 15
- 376
- 0
Báo cáo y học: " A remission spectroscopy system for in vivo monitoring of hemoglobin oxygen saturation in murine hepatic sinusoids, in early systemic inflammation" doc
... administered at a rate of 0.4 ml/hr to maintain normal mean arterial pressure As formerly described [4], and for the realization of the intravital microscopy procedure in anaesthetized animals, a transverse ... probe was calibrated according to the technical instructions of the manufacturer Measurement of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels Blood was collected ... on the Care and Use of Laboratory Animals of the Institute of Laboratory Animal Page of (page number not for citation purposes) Comparative Hepatology 2005, 4:1 http://www.comparative-hepatology.com/content/4/1/1...
- 8
- 239
- 0
Development of micro total analysis system for detection of water pathogens
... demand for a faster analytical method for the above purpose 1.1 Objective The main objective of this project was to develop a micro total analysis system as a faster analytical method for the ... sustain life, and a satisfactory (adequate, safe and accessible) supply must be available to all One of the most important attributes of good quality water is to be free of disease-causing organisms-pathogenic ... Procedures for DNA Microarray 145 Appendix L DNA Microarray Surface Modification Protocol 146 Appendix M Operating Procedures for BioChip Arrayer 147 Appendix N Operating Procedures for Micro Total Analysis...
- 169
- 281
- 0
CONVERGENCE ANALYSIS OF A PROXIMAL POINT ALGORITHM FOR MINIMIZING DIFFERENCES OF FUNCTIONS
... past three decades, Pham Dinh Tao, Le Thi Hoai An and many others have contributed to providing mathematical foundation for the algorithm and making it accessible for applications The (DCA) ... like to thank the VIASM for financial support and hospitality The research of the second author was partially supported by the USA National Science Foundation under grant DMS-1411817 and the Simons ... minimization of DC Functions, Journal of Computational Mathematics, 21, 451-462 (2003) 12 Moudafi, A. , Maing´e, P E.: On the convergence of an approximate proximal method for DC functions, Journal of...
- 23
- 319
- 0
IC implementation of a bioelectric acquisition system for medical application
... Schematic diagram of a two stage operational amplifier 45 Figure 4.5 A resistor capacitor equivalent model of a MOSFET switch 49 Figure 4.6 (a) Transition of gate voltage in a transmission gate ... aliasing noises before it is converted to digital signals Lastly, as even a small deviation of the bioelectric signals is important in the diagnosis of a patient; an accurate analog-to-digital ... Test and Evaluation of the Initial Fabricated IC CHAPTER TEST AND EVALUATION OF THE INITIAL FABRICATED IC 2.1 Introduction An earlier version of the bioelectric acquisition system was sent for fabrication...
- 135
- 231
- 0
Modelling study of a container distribution system for high rise factories
... Prototype of Krupp Fast Handling System (From [9]) Krupp, a German manufacturer of marine cranes and mining material handling, has developed an automated system design specifically for intermodal rail ... (through a large ramp for container trucks), private loading areas and car parks The ramp has to be wide enough to accommodate the turning radius of 40-ft trucks and large access roads have to ... models are available, they should be used, and that simulation should be resorted for cases where either analytical models are not available and approximations are not acceptable or they are so...
- 80
- 276
- 0
NGHIÊN cứu CHẾ tạo THIẾT bị THU NHẬN bề mặt 3d của CHI TIẾT cơ KHÍ BẰNG CÔNG NGHỆ ÁNH SÁNG cấu TRÚC STUDY AND FABRICATION OF a 3d SCANNING SYSTEM FOR RECONSTRUCTION 3d SURFACE OF MECHANICAL DETAILS ACQUIRED BY STRUCTURED LIGHT TECHNIQUE
... high frequency illumination”, ACM Trans on Graphics, 935-944,2006 [6] Z Zhang, A Flexible New Technique for Camera Calibration”, IEEE Transactions on Pattern Analysis and Machine Intelligence, ... Projector-Camera Calibration”, IEEE, 2012 Second International Conference on,464-471, 2012 [5] S K Nayar, G Krishnan, M D Grossberg, R Raskar, “Fast separation of direct and global components of a scene using ... classification for 3D modeling with structured light”, in Proceedings of Graphics Interface, 233–240, 2007 [4] Daniel Moreno, Gabriel Taubin, “Simple, Accurate, and Robust Projector-Camera Calibration”,...
- 8
- 470
- 2
A Fast File System for UNIX
... insufficient space to hold the new data) If space exists in a block already allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full ... expected amount of time that it takes to start a new disk transfer operation For programs that sequentially access large amounts of data, this strategy minimizes the amount of time spent waiting for ... remainder of an entry is variable length and contains a null terminated file name, padded to a byte boundary The maximum length of a file name in a directory is currently 255 characters Available...
- 14
- 1,023
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008