0

a flow chart summary of the itraq™ experiment design of 4 plex and 8 plex systems 63

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Tổng hợp

... 13 A flow- chart summary of the iTRAQ™ experiment design of 4- plex and 8plex systems 63 Figure 14 Histogram of mean signal area (intensity) of reporter channels 73 Figure 15 Assessment ... protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of protein characteristics that make up a proteome, complementary ... that 14% of patients had hypertrophic cardiomyopathy, 13% of patients with ophthalmoplegia, 7 .4% of maternally inherited deafness, and 6.9% of those with occipital stroke (Majamaa et al., 19 98) ...
  • 226
  • 1,830
  • 0
Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học

... the vast majority of the examined hepatocytes Steatosis was diffuse and of the macrovesicular type, in which a large fat vacuole within the hepatocyte pushed the nucleus towards the edge of the ... determine the rate of intestinal triglyceride secretion in the plasma of our experimental mice, we measured the total rate of plasma triglyceride input (intestinal and hepatic) and subtracted the rate ... whereas another epidemiological study supported a correlation of the e4 allele with increased pathogenesis of fatty liver disease [ 34] As the human apoE2 isoform of apoE is far less efficient than...
  • 11
  • 544
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Exploring the molecular mechanisms underlying the potentiation of exogenous growth hormone on alcohol-induced fatty liver diseases in mice" ppt

Hóa học - Dầu khí

... antiphosphorylated-AMP-activated protein kinase (AMPK) -a (anti-p-AMPKa), anti-AMPKa, anti-p- peroxisome proliferator activated receptor -a (PPARa), anti-PPAR -a, anti-phosphorylated acetyl CoA carboxylase (p-ACC) ... administration can ameliorate AFLD by activating multiple hepatic signaling cascades, including the hepatic SIRT1-AMPK and PPARa-AMPK signaling pathways GH may offer a novel and promising therapeutic ... regulate adipocyte adiponectin and adipoR2 expression via the JAK2 and p 38 MAPK pathways, and raise serum HMW adiponectin, the most active adiponectin isoform in the regulation of insulin and...
  • 15
  • 392
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The Acute Liver Injury in Mice Caused by Nano-Anatase TiO2" docx

Hóa học - Dầu khí

... that higher dose nanoTiO2 (25 and 80 nm) increased the ratio of alanine aminotransferase to aspartate aminotransferase, the activity of lactate dehydrogenase and the liver weight, and caused the ... GTTGCCTTCTTGGGACTGATG, mil6r: ACTCTTTTCTCATTTCCACGATTT, 172 bp; mil10f: TGGACAACATACTGCTAACCGAC, mil10r: CCTGGGG CATCACTTCTACC, 111 bp; mcrpf: GCGGAAAAGTCTGCACAAGG, mcrpr:GGAGATAGCACAAAGTCCCACAT, 153 ... Liver The DNA was extracted from the liver and purified as described by the manual of DNA kits (Takara company), A2 60 /A2 80 ([1 .8) indicated that the DNA was sufficiently free of protein The purified...
  • 11
  • 429
  • 0
báo cáo khoa học:

báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

Báo cáo khoa học

... http://www.jnanobiotechnology.com/content/9/1/15 TTCAGAACC-3’ (291 bp), Alb S:5’-TCAACGTCAGAGCAGAGAAGC-3’, A: 5’-AGACTGCCTTGTGTGGAAGACT-3’, ( 145 ), AFP S: 5’-GTGAAACAGACTT CCTGGTCCT -3’, A: 5’-GCC CACAGACCATGAAACAAG-3’(bp 1 48 ) RT-PCR was used ... 101:2999-3001 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M, Takimoto R, Iyama S, Matsunaga T, Ohtani S, Matsuura A, Hamada H, Niitsu Y: Humanmesenchymal ... histological, immunostaining and gene expression assays described in the manuscript, statistical data analysis and has drafted the manuscript CR has provided the interpretation of data of the entire manuscript...
  • 11
  • 404
  • 0
Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc

Báo cáo khoa học

... Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S & Ohta S (2007) Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals Nat Med 13, 688 –6 94 Nathan C ... mode of type II programmed cell death, autophagy plays a major role in the degradation and recycling of intracellular materials [5] Macroautophagy, the most universal form of autophagy, is the ... cytoplasm vacuolization, and some autophagic vacuoles contained degraded organelles, such as mitochondria The formation of autophagic vacuoles was further assessed by monodansylcadaverine (MDC) staining...
  • 16
  • 547
  • 0
Arsenic immobilization by calcium arsenic precipitates in lime treated soils

Arsenic immobilization by calcium arsenic precipitates in lime treated soils

Môi trường

... Ca(OH)2 Ca4(OH)2(AsO4)2•4H2O, CaCO3, Ca(OH)2 4 4 4 Ca–As–O, CaCO3, Ca(OH)2 4 4 NaCaAsO4•7.5H2O, Ca5(AsO4)3OH, CaCO3, Ca(OH)2 Ca4(OH)2(AsO4)2•4H2O, CaCO3, Ca(OH)2 4 ARTICLE IN PRESS CayAs molar ratio ... 1.5 4 2.5 4 Lime–NaAsO2wAs(III)x Phases Lime–Na2HAsO4•7H2OwAs(V)x Phases Ca–As–O, CaCO3, Ca(OH)2 NaCaAsO4•7.5H2O, Ca5(AsO4)3OH, CaCO3, Ca(OH)2 NaCaAsO4•7.5H2O, Ca4(OH)2(AsO4)2•4H2O, CaCO3, Ca(OH)2 ... TCLP As concentrations were highest (29 28 mgyl) at a CayAs molar ratio of 1:1 and the lowest (1 .4 mgy l) at a CayAs molar ratio of 4: 1 At a CayAs molar ratio of 1:1, NaCaAsO4•7.5H2O showed the...
  • 15
  • 320
  • 0
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Báo cáo khoa học

... 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS 84 , 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ PCR products ... polymerase (NEB, Ipswich, MA, USA) as the amplification enzyme, pCDA401 as a template and the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; ... forward primer 5¢-CTCGAGACAATACAATTGTCCAGG-3¢, and reverse primer 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and the PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then...
  • 18
  • 400
  • 0
Nonalcoholic fatty liver disease in children living in the obeseogenic society doc

Nonalcoholic fatty liver disease in children living in the obeseogenic society doc

Sức khỏe trẻ em

... children with NAFLD and normal aminotransferases not exclude the presence of advanced disease.[16] Serum alkaline phosphatase and gamma-glutamyl transpeptidase may also be mildly abnormal Albumin, ... 20 04; 19:537- 544 94 Duseja A, Murlidharan R, Bhansali A, Sharma S, Das A, Das R, et al Assessment of insulin resistance and effect of metformin in nonalcoholic steatohepatitis a preliminary report Indian ... inflammation and cell death. [4, 5] Epidemiology 246 The exact prevalence of NAFLD is not known because of the lack of accurate noninvasive diagnostic modalities Although imaging methods can diagnose...
  • 10
  • 316
  • 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

Sức khỏe trẻ em

... for the age range of our patient population {Based on percentile for age and sex ALT, alanine aminotransferase; ANA, antinuclear antibody; AST, serum aspartate aminotransferase; GGT, c-glutamyl ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... survival of the general population of the same age and sex; our children with NAFLD had a 13 .8- fold higher risk of dying or requiring liver transplantation than the general population of the same age...
  • 7
  • 487
  • 0
Liver disease in children - Dr. Ahmed Al-Sarkhy, MD, MHSc, FAAP, FRCPC potx

Liver disease in children - Dr. Ahmed Al-Sarkhy, MD, MHSc, FAAP, FRCPC potx

Sức khỏe trẻ em

... of the liver are observed with leukemia, lymphoma, and neuroblastoma • Primary liver tumors: Hepatoblastoma, hepatocarcinoma, and hemangioendothelioma • Presentation: hepatomegaly or abdominal ... and AST) • In hepatocellular disease, the serum levels of GGT and AP not rise to the same degree as the aminotransferases Causes of liver disease in neonates & infants Causes of liver disease ... interlobular bile ducts, periportal fibrosis, and bile plugs in canaliculi and ductules Hepato-biliary scintigraphy (HIDA scan) BA NORMAL HIDA SCAN BA Management • Surgical correction (Kasai portoenterostomy)...
  • 45
  • 316
  • 0
Autoimmune Liver Disease in Children potx

Autoimmune Liver Disease in Children potx

Sức khỏe trẻ em

... fulfilled these remission criteria All patients had ANA/SMA Treatment withdrawal was accomplished after a median treatment duration of 3.2 years (range, to 11 years), and remission was sustained in all ... was revealed after the incidental discovery of abnormal liver tests Inflammatory bowel disease was present in 44 % of children with cholangiopathy, compared to 18% of those with typical AIH, and ... corticosteroids and no biliary changes on several followup liver biopsy specimens This experience suggests that AIH and ASC are part of the same pathogenic process and that prednisolone and azathioprine may...
  • 5
  • 345
  • 0
Identification of antibacterial species in plasma treated liquids

Identification of antibacterial species in plasma treated liquids

Sinh học

... chloride (NaCl) solution ( ) as well as addition to E coli of plasmatreated NaCl solution immediately (ж) or 30 after plasma treatment ( ) [1] Additionally, total spectra of plasma treated water and ... detectors As eluent 4. 5 mM disodium carbonate and 0 .8 mM sodium hydrogencarbonat was used The flow was 0.25 ml ⋅ min-1 For data analyzing the software Chromeleon (Dionex) was used Results and Discussion ... that the inactivating effect of the plasma treatment is mainly mediated by the liquid phase But which species caused this effect? Therefore the plasma/gas phase were analysed by OES and FT-IR...
  • 4
  • 302
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc

Hóa học - Dầu khí

... 0. 28 (0.2–1 .87 ) 0.51 (0.2–2.72) 760 (47 2–9 08) 1197 (9 04 149 1) 8 84 (47 2– 149 1) 11 68 (6 94 3 142 ) 760 ( 48 8 1032) 1032 ( 48 8 3 142 ) 13 30 34 (41 4–37 84 ) 3 044 (765–3111) 3039 (41 4–37 84 ) 45 .5 (25 .4 58. 1) 46 .1 ... h (% of A0 × h) Amin (% of A0 ) Amax (% of A0 ) Data are given as median (range) The belatacept group includes patients at week 13 and for the maximum, minimum and AUC calculations at week A0 , predose ... to the development of analytical methods SB and NTV prepared the samples and performed sample and data analyzes NTV, HR and StB helped to interpret data and draft the manuscript written by SB All...
  • 14
  • 532
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

Hóa học - Dầu khí

... pulmonary metastasis of mammary carcinomas by enhancing protumor properties of macrophages Cancer Cell 2009, 16(2):91-102 48 Mantovani A, Sica A, Allavena P, Garlanda C, Locati M: Tumor-associated ... ratio, and linear-by-linear association, as appropriate The cumulative survival time was computed using the Kaplan-Meier method and compared by the log-rank test Univariate and multivariate analyses ... and reduced patient survival Int J Cancer 20 08, 123 (4) : 780 - 786 21 Hanada T, Nakagawa M, Emoto A, Nomura T, Nasu N, Nomura Y: Prognostic value of tumor-associated macrophage count in human bladder...
  • 9
  • 828
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Hóa học - Dầu khí

... performed data collection and statistical analyses, and wrote and helped edit the manuscript AN assisted with experimental design, performed data collection and statistical analyses, and wrote and helped ... for asparaginase and asparaginase plus rapamycin treated animals (b) Survival curve for indicated treatment cohorts Based on survival analysis and comparison of tumor volumes on day 30, asparaginase ... of Translational Medicine 2010, 8: 14 http://www.translational-medicine.com/content /8/ 1/ 14 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 the kidney, brain, and skin are angiogenic neoplasms...
  • 18
  • 611
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

Hóa học - Dầu khí

... change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda to IgG/kappa) Statistical analysis OS was defined as time from commencement of induction therapy to death or last ... J Haematol 20 08, 143 doi:10.1 186 / 147 9- 587 6 -8- 1 24 Cite this article as: Chim: Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/ thalidomide/dexamethasone ... Sureda A, de la Rubia J, Garc a- Lara a J, Martínez-Martínez R, Hernández-Garc a MT, Carrera D, Besalduch J, de Arriba F, Ribera JM, Escoda L, Hernández-Ruiz B, Garc a- Frade J, Rivas-González C, Alegre...
  • 7
  • 489
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt

Hóa học - Dầu khí

... conducted experiments together XW wrote the manuscript KNZ designed and coordinated the research efforts and edited the manuscript All co-authors read and approved the final manuscript 18 Green ... association of the HPV life cycle with the differentiation state of its host cell is demonstrated by the restriction of late gene transcription and amplification of viral DNA to suprabasal epithelial ... above At 48 h posttransfection, the L1-transfected KCs were harvested for analysing L1 transcripts and proteins (Fig 3) Again, quantitative RT-PCR was used to examine transcripts of both Nat and...
  • 6
  • 394
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf

Hóa học - Dầu khí

... PFC [ 38] Our analysis indicates that the LZ estimators and entropy are useful tools for the characterization of the dynamical changes in VTA DA neuronal activity As demonstrated in our analysis, ... experiments and helped to write the manuscript, AD contributed to the data analysis and helped to write the manuscript, YMA helped with the experiments and helped to write the paper MA oversaw the data ... window and the values were averaged The same procedure was applied for segments before and after nicotine exposure The data analyzed for nicotine effect was taken after firing rate of DA neuron has...
  • 8
  • 403
  • 0
báo cáo hóa học:

báo cáo hóa học: " Focal glial activation coincides with increased BACE1 activation and precedes amyloid plaque deposition in APP[V717I] transgenic mice" pptx

Hóa học - Dầu khí

... AD-like histopathology, i.e amyloid plaques and cerebral amyloid angiopathy (CAA) [4- 6](3 8) [7 ,8] The eventual deposition of A and the neurofibrillary tangle formation may not account for all, ... 5'-TTCTGTTTTCTGTATGCTGTCC-3'; IL1β forward 5'-CCTGTGTAATGAAAGACGGC-3' and IL-1β reverse 5'-AAGGGA GCTCCTTCACA TGC-3'; GAPDH forward 5'-TCACCAGGGCTGCCATTTGC-3' and GAPDH reverse 5'-GACTCCACGACATACTCAGC-3'; ... arrows Focal astroglial activation within the parenchyma by black arrows and at the side of of a brain vessel by a white arrow (B) Quantification of hippocampal (HC, open bar) and cortical (FC,...
  • 12
  • 216
  • 0

Xem thêm