... 13 A flow- chartsummaryoftheiTRAQ™experimentdesignof 4- plexand 8plex systems63 Figure 14 Histogram of mean signal area (intensity) of reporter channels 73 Figure 15 Assessment ... protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of protein characteristics that make up a proteome, complementary ... that 14% of patients had hypertrophic cardiomyopathy, 13% of patients with ophthalmoplegia, 7 .4% of maternally inherited deafness, and 6.9% of those with occipital stroke (Majamaa et al., 19 98) ...
... the vast majority ofthe examined hepatocytes Steatosis was diffuse andofthe macrovesicular type, in which a large fat vacuole within the hepatocyte pushed the nucleus towards the edge ofthe ... determine the rate of intestinal triglyceride secretion in the plasma of our experimental mice, we measured the total rate of plasma triglyceride input (intestinal and hepatic) and subtracted the rate ... whereas another epidemiological study supported a correlation ofthe e4 allele with increased pathogenesis of fatty liver disease [ 34] As the human apoE2 isoform of apoE is far less efficient than...
... antiphosphorylated-AMP-activated protein kinase (AMPK) -a (anti-p-AMPKa), anti-AMPKa, anti-p- peroxisome proliferator activated receptor -a (PPARa), anti-PPAR -a, anti-phosphorylated acetyl CoA carboxylase (p-ACC) ... administration can ameliorate AFLD by activating multiple hepatic signaling cascades, including the hepatic SIRT1-AMPK and PPARa-AMPK signaling pathways GH may offer a novel and promising therapeutic ... regulate adipocyte adiponectin and adipoR2 expression via the JAK2 and p 38 MAPK pathways, and raise serum HMW adiponectin, the most active adiponectin isoform in the regulation of insulin and...
... that higher dose nanoTiO2 (25 and 80 nm) increased the ratio of alanine aminotransferase to aspartate aminotransferase, the activity of lactate dehydrogenase andthe liver weight, and caused the ... GTTGCCTTCTTGGGACTGATG, mil6r: ACTCTTTTCTCATTTCCACGATTT, 172 bp; mil10f: TGGACAACATACTGCTAACCGAC, mil10r: CCTGGGG CATCACTTCTACC, 111 bp; mcrpf: GCGGAAAAGTCTGCACAAGG, mcrpr:GGAGATAGCACAAAGTCCCACAT, 153 ... Liver The DNA was extracted from the liver and purified as described by the manual of DNA kits (Takara company), A2 60 /A2 80 ([1 .8) indicated that the DNA was sufficiently free of protein The purified...
... http://www.jnanobiotechnology.com/content/9/1/15 TTCAGAACC-3’ (291 bp), Alb S:5’-TCAACGTCAGAGCAGAGAAGC-3’, A: 5’-AGACTGCCTTGTGTGGAAGACT-3’, ( 145 ), AFP S: 5’-GTGAAACAGACTT CCTGGTCCT -3’, A: 5’-GCC CACAGACCATGAAACAAG-3’(bp 1 48 ) RT-PCR was used ... 101:2999-3001 Sato Y, Araki H, Kato J, Nakamura K, Kawano Y, Kobune M, Sato T, Miyanishi K, Takayama T, Takahashi M, Takimoto R, Iyama S, Matsunaga T, Ohtani S, Matsuura A, Hamada H, Niitsu Y: Humanmesenchymal ... histological, immunostaining and gene expression assays described in the manuscript, statistical data analysis and has drafted the manuscript CR has provided the interpretation of data ofthe entire manuscript...
... Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S & Ohta S (2007) Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals Nat Med 13, 688 –6 94 Nathan C ... mode of type II programmed cell death, autophagy plays a major role in the degradation and recycling of intracellular materials [5] Macroautophagy, the most universal form of autophagy, is the ... cytoplasm vacuolization, and some autophagic vacuoles contained degraded organelles, such as mitochondria The formation of autophagic vacuoles was further assessed by monodansylcadaverine (MDC) staining...
... 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS 84 , 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ PCR products ... polymerase (NEB, Ipswich, MA, USA) as the amplification enzyme, pCDA401 as a template andthe following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; ... forward primer 5¢-CTCGAGACAATACAATTGTCCAGG-3¢, and reverse primer 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, andthe PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then...
... children with NAFLD and normal aminotransferases not exclude the presence of advanced disease.[16] Serum alkaline phosphatase and gamma-glutamyl transpeptidase may also be mildly abnormal Albumin, ... 20 04; 19:537- 544 94 Duseja A, Murlidharan R, Bhansali A, Sharma S, Das A, Das R, et al Assessment of insulin resistance and effect of metformin in nonalcoholic steatohepatitis a preliminary report Indian ... inflammation and cell death. [4, 5] Epidemiology 246 The exact prevalence of NAFLD is not known because ofthe lack of accurate noninvasive diagnostic modalities Although imaging methods can diagnose...
... for the age range of our patient population {Based on percentile for age and sex ALT, alanine aminotransferase; ANA, antinuclear antibody; AST, serum aspartate aminotransferase; GGT, c-glutamyl ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... survival ofthe general population ofthe same age and sex; our children with NAFLD had a 13 .8- fold higher risk of dying or requiring liver transplantation than the general population ofthe same age...
... ofthe liver are observed with leukemia, lymphoma, and neuroblastoma • Primary liver tumors: Hepatoblastoma, hepatocarcinoma, and hemangioendothelioma • Presentation: hepatomegaly or abdominal ... and AST) • In hepatocellular disease, the serum levels of GGT and AP not rise to the same degree as the aminotransferases Causes of liver disease in neonates & infants Causes of liver disease ... interlobular bile ducts, periportal fibrosis, and bile plugs in canaliculi and ductules Hepato-biliary scintigraphy (HIDA scan) BA NORMAL HIDA SCAN BA Management • Surgical correction (Kasai portoenterostomy)...
... fulfilled these remission criteria All patients had ANA/SMA Treatment withdrawal was accomplished after a median treatment duration of 3.2 years (range, to 11 years), and remission was sustained in all ... was revealed after the incidental discovery of abnormal liver tests Inflammatory bowel disease was present in 44 % of children with cholangiopathy, compared to 18% of those with typical AIH, and ... corticosteroids and no biliary changes on several followup liver biopsy specimens This experience suggests that AIH and ASC are part ofthe same pathogenic process and that prednisolone and azathioprine may...
... chloride (NaCl) solution ( ) as well as addition to E coli of plasmatreated NaCl solution immediately (ж) or 30 after plasma treatment ( ) [1] Additionally, total spectra of plasma treated water and ... detectors As eluent 4. 5 mM disodium carbonate and 0 .8 mM sodium hydrogencarbonat was used Theflow was 0.25 ml ⋅ min-1 For data analyzing the software Chromeleon (Dionex) was used Results and Discussion ... that the inactivating effect ofthe plasma treatment is mainly mediated by the liquid phase But which species caused this effect? Therefore the plasma/gas phase were analysed by OES and FT-IR...
... 0. 28 (0.2–1 .87 ) 0.51 (0.2–2.72) 760 (47 2–9 08) 1197 (9 04 149 1) 8 84 (47 2– 149 1) 11 68 (6 94 3 142 ) 760 ( 48 8 1032) 1032 ( 48 8 3 142 ) 13 30 34 (41 4–37 84 ) 3 044 (765–3111) 3039 (41 4–37 84 ) 45 .5 (25 .4 58. 1) 46 .1 ... h (% of A0 × h) Amin (% of A0 ) Amax (% of A0 ) Data are given as median (range) The belatacept group includes patients at week 13 and for the maximum, minimum and AUC calculations at week A0 , predose ... to the development of analytical methods SB and NTV prepared the samples and performed sample and data analyzes NTV, HR and StB helped to interpret data and draft the manuscript written by SB All...
... pulmonary metastasis of mammary carcinomas by enhancing protumor properties of macrophages Cancer Cell 2009, 16(2):91-102 48 Mantovani A, Sica A, Allavena P, Garlanda C, Locati M: Tumor-associated ... ratio, and linear-by-linear association, as appropriate The cumulative survival time was computed using the Kaplan-Meier method and compared by the log-rank test Univariate and multivariate analyses ... and reduced patient survival Int J Cancer 20 08, 123 (4) : 780 - 786 21 Hanada T, Nakagawa M, Emoto A, Nomura T, Nasu N, Nomura Y: Prognostic value of tumor-associated macrophage count in human bladder...
... performed data collection and statistical analyses, and wrote and helped edit the manuscript AN assisted with experimental design, performed data collection and statistical analyses, and wrote and helped ... for asparaginase and asparaginase plus rapamycin treated animals (b) Survival curve for indicated treatment cohorts Based on survival analysis and comparison of tumor volumes on day 30, asparaginase ... of Translational Medicine 2010, 8: 14 http://www.translational-medicine.com/content /8/ 1/ 14 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 the kidney, brain, and skin are angiogenic neoplasms...
... change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda to IgG/kappa) Statistical analysis OS was defined as time from commencement of induction therapy to death or last ... J Haematol 20 08, 143 doi:10.1 186 / 147 9- 587 6 -8- 1 24 Cite this article as: Chim: Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/ thalidomide/dexamethasone ... Sureda A, de la Rubia J, Garc a- Lara a J, Martínez-Martínez R, Hernández-Garc a MT, Carrera D, Besalduch J, de Arriba F, Ribera JM, Escoda L, Hernández-Ruiz B, Garc a- Frade J, Rivas-González C, Alegre...
... conducted experiments together XW wrote the manuscript KNZ designed and coordinated the research efforts and edited the manuscript All co-authors read and approved the final manuscript 18 Green ... association ofthe HPV life cycle with the differentiation state of its host cell is demonstrated by the restriction of late gene transcription and amplification of viral DNA to suprabasal epithelial ... above At 48 h posttransfection, the L1-transfected KCs were harvested for analysing L1 transcripts and proteins (Fig 3) Again, quantitative RT-PCR was used to examine transcripts of both Nat and...
... PFC [ 38] Our analysis indicates that the LZ estimators and entropy are useful tools for the characterization ofthe dynamical changes in VTA DA neuronal activity As demonstrated in our analysis, ... experiments and helped to write the manuscript, AD contributed to the data analysis and helped to write the manuscript, YMA helped with the experiments and helped to write the paper MA oversaw the data ... window andthe values were averaged The same procedure was applied for segments before and after nicotine exposure The data analyzed for nicotine effect was taken after firing rate of DA neuron has...
... AD-like histopathology, i.e amyloid plaques and cerebral amyloid angiopathy (CAA) [4- 6](3 8) [7 ,8] The eventual deposition ofAandthe neurofibrillary tangle formation may not account for all, ... 5'-TTCTGTTTTCTGTATGCTGTCC-3'; IL1β forward 5'-CCTGTGTAATGAAAGACGGC-3' and IL-1β reverse 5'-AAGGGA GCTCCTTCACA TGC-3'; GAPDH forward 5'-TCACCAGGGCTGCCATTTGC-3' and GAPDH reverse 5'-GACTCCACGACATACTCAGC-3'; ... arrows Focal astroglial activation within the parenchyma by black arrows and at the side ofofa brain vessel by a white arrow (B) Quantification of hippocampal (HC, open bar) and cortical (FC,...