... pancreas Biochim Biophys Acta 663, 446–456 6022 A Berton et al 13 De Caro J, Sias B, Grandval P, Ferrato F, Halimi H, Carriere F & De Caro A (2004) Characterization of pancreatic lipase-related ... the reacting antibodies were detected with goat anti-rabbit IgG conjugated with alkaline phosphatase at a : 5000 dilution Activity measurements and protein assays The lipase activity was measured ... BioWhittaker (Walkersville, MD, USA) Antibiotics were obtained from Invitrogen (Carlsbad, CA, USA) Alkaline phosphatase-labeled goat anti-(rabbit IgG), E600, tributyrin and NaTDC were purchased...
... Tzartos SJ, Barkas T, Cung MT, Mamalaki A, Marraud M, Orlewski P, Papanastasiou D, Sakarellos C, Sakarellos-Daitsiotis M, Tsantili P, et al (1998) Anatomy of the antigenic structure of a large ... 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1– 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ ... recombinant ECDs Discussion (anti -a sera) and others with a very small proportion of antibodies against a (nonanti -a sera) [26] We incubated five nonanti -a and one anti -a (82% antibodies against a) ...
... TTATCAG-3¢; C45 8A( antisense) 5¢-ATCTGATAACAC AGCCCACTCAAGTAT-3¢; C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT ... 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ PCRs were performed applying standard procedures All plasmids were sequenced using an ABI Prism Automated sequencer ... AGACTGGACACATGG-3¢ and 5¢-TCGGGCCATGGC ATGCCCGGGGGTCAGAGCTGGG-3¢ for amplification of D4 of GCSFR and 5¢-TACTCTCAAGAAATG CCCGGGTCCCATGCCCCAGAG-3¢ and 5¢-GCCCAG GATGATGTGTAGCTCCCCGGGCTCTGGGGTCAA GGT-3¢ for...
... presumably rational to expect that VnfA also causes a conformational change in a similar manner to NifA; the binding of the ATP analog induces the rearrangement of the GAF and possible AAA+ (the ... 5¢-CAAAAGGTCTCGAATGTCCAGC CTCCCCCAATA-3¢ and 5¢-CAAAAGGTCTCAGCGCTG CGGTAGTCCTTGTAGTTGA-3¢ After digestion with BsaI, the PCR product was ligated into the BsaI site of pASK-IBA3plus The resulting plasmid, ... lacZ A consistent result was also obtained by the b-galactosidase (b-gal activity) assay (Table S3) The accumulation of b-gal in the reporter strain was at the same level after the aerobic and...
... leading toa conformation that was inactive Recent structural data from the Archaeoglobus fulgidus copper ATPase are in agreement with such interactions [47] To alleviate these inhibitory domain–domain ... copper-dependent interactions between Atx1 and Ccc2 and further copper transfer into the TGN lumen by Ccc2 are required to activate high-affinity iron uptake in yeast (Fig 1A) Atx1 is a 73-amino -acid cytosolic ... 1528–1539 14 Arnesano F, Banci L, Bertini I, Ciofi-Baffoni S, Molteni E, Huffman DL & O’Halloran TV (2002) Metallochaperones and metal-transporting ATPases: a comparative analysis of sequences and structures...
... chromatography (Fig 2A) The recombinant ClpC1 was analyzed to determine if it had an inherent ATPase activity We used radioactive ATP as the substrate and quantified the radioactive inorganic phosphate ... basal ATPase activity and has chaperone activity in preventing the aggregation of luciferase and reactivating heat-inactivated luciferase Deletion of the N-terminal conserved repeat I (amino acids ... in an alteration in the conformation and stability of ClpC1 Although, ClpC1D1 had full ATPase activity with a Km value for ATP similar to that of the native protein, it failed to prevent heat-induced...
... particle release from polarised epithelial cells was shown to occur at both apical and basolateral membrane surfaces, yet in its presence release occurred exclusively at the basolateral membrane ... signalling cascades that govern polarisation of HIV-1 Gag to the VS have been identified [18], it remains unclear which domains of viral Env and Gag proteins are operational in mediating transport ... HIV-CA, was established by intracellular p24 FACS (10,000 gated cells were analysed in each case) The value obtained for pNL-Wt was set at 100% and the values for pNL-Tr712 and pNL-EnvFus- calculated...
... Software (Applied Biosystems) based on published rhesus macaque sequences IFNγ : F – GAAAAGCTGACCAATTATTCGGTAA, R – GCGACAGTTCAGCCATCACTT, P – 5'FAM – CCAACGCAAAGCAGTACATGAACTCATCC – TAMRA-3'; ... GTCATCGATTTCTTCCCTGTGAA R – CTTGGAGCTTACTAAAGGCATTCTTC P – 5'FAM – CCTGCTCCACGGCCTTGCTCTTG – 3'TAMRA; IL-12p40: F – TGAAGAAAGACGTTTATGTTGTAGAATTG, R – TGGTCCAAGGTCCAGGTGAT, RNA isolation and ... forward and reverse PCR primers were SIVgagF AGTACGGCTGAGTGAAGGCAGTA and SIVgagR GACCCGCGCCTTTATAGGA, respectively The fluorogenic SIVgag probe CGGCAGGAACCAACCACGACG was modified with FAM/TAMRA...
... diphosphate Ala : Alanine (A) AP : Adaptor protein complex APP : Amyloid precursor protein Arf : ADP-ribosylation factor Arg : Arginine (R) ARH : Autosomal recessive hypercholesterolemia protein Arl ... : Arf-like protein Asp : Aspartic acid (D) ATP : Adenosine triphosphate ATPase: Adenosine triphosphatase BACE2: β-site APP-cleaving enzyme Bet : Block early in transport BFA : Brefeldin A BFLA1: ... biosynthetic/secretory pathway, through the Golgi apparatus and eventually to the ER, from which the enzyme subunits are ultimately released into the cytosol and lead to harmful reactions (Sandvig and van Deurs,...
... under a microscope At least 100 cells were counted for each treatment Statistical analysis was performed using GraphPad InStat (GraphPad Software, San Diego, California, USA) Anticancer activity ... folds at stage III in prostate cancer (Fig 1) Because cancer undergoes metastasis and spreads to other organs at late stages, we speculated that RIZ1 might play an important role in tumor metastasis, ... Natl Acad Sci USA 2000; 97: 2662-7 Sasaki O, Meguro K, Tohmiya Y, Funato T, Shibahara S, Sasaki T Altered expression of retinoblastoma protein-interacting zinc finger gene, RIZ, in human leukaemia...
... GI, Hatakeyama M et al (2005) Activation of beta-catenin by carcinogenic Helicobacter pylori Proc Natl Acad Sci USA 102, 10646–10651 19 Ohnishi N, Yuasa H, Tanaka S, Sawa H, Miura M, Matsui A, ... effectors across the basolateral membrane (Fig 1) A possible scenario is that early exposed cagPAI-independent factors such as the H pylori adhesins, as well as HtrA, VacA, OipA and others, may ... not CagA because isogenic cagA mutants also blocked phagocytosis These data indicate that H pylori expresses a yet unknown T4SS factor exhibiting antiphagocytic activity, which may play an essential...
... Database are integrated with the World Bank’s Open Data initiative Some of the data are new, and this is the first time such comprehensive data are available The data are made available in a ... Director, Financial Systems Global Practice and East Asia and Pacific Region, Financial and Private Sector Vice Presidency, World Bank Abbreviations and Glossary ATP/TA after-tax profits to assets ... Demirgüç-Kunt, Augusto Lopez-Claros, Gaiv Tata, Gerardo Corrochano, Janamitra Devan, Klaus Tilmes, Loic Chiquier, Marialisa Motta, Pierre Guislain, Sujata Lamba, Tilman Ehrbeck, and Tunc Uyanik) as well as...
... domain, and this autoinhibitory activity appears to be a general feature of Meis family proteins Previous work has identified a transcriptional AD C-terminal to the HD of Meis 1a [40] When assayed ... to the AD As the autoinhibition affected an unrelated AD when this was put in place of the native Meis2d AD, it appears that any intramolecular interactions with the Hth domain are likely to be ... compilation ª 2010 FEBS C Hyman-Walsh et al Meis2 transcriptional activation A B D C E Fig Mutational analysis of hr2 (A) An alignment of the Hth domains from Meis relatives is shown Amino acids...
... Kito M, Kondo J, Kagaya S, Qin L, Takata H, Miyazawa K et al (1997) Hepatocyte growth factor activator inhibitor, a novel Kunitz-type serine protease inhibitor J Biol Chem 272, 6370–6376 Kawaguchi ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- Crystal structure of the catalytic domain ... SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA domain may...
... Omura S, Ikeda H, Ishikawa J, Hanamoto A, Takahashi C, Shinose M, Takahashi Y, Horikawa H, Nakazawa H, Osonoe T, et al (2001) Genome sequence of an industrial microorganism Streptomyces avermitilis: ... it to display monophenolase and o-diphenolase activity or just the latter activity For instance, all catechol oxidases from tomato, potato and beans have the aromatic residue at the equivalent ... A novel tyrosinase from Rastonia solanacearum ´ D Hernandez-Romero et al A B C particular catechol to o-dopaquinone is also called dopa oxidase (DO) activity On the other hand, laccases...
... 273–379 P39272 233–339 PFAM PAC NA NA NA NA NA NA NA NA NA NA PAC PAC PAC PACa PAC PAC PAC PAC PAC PAC PAC PAC PAC NA NA B_19516 PROSA z-score (best model) z-Score after Align-2D (best model) )6.04 ... representative PAS proteins, is depicted in Fig We conclude from this alignment that all PAS-annotated A thaliana proteins also contain a PAC motif, and conversely that all PACannotated A thaliana proteins ... 95–201 NA P30663 36–144 P30663 162–268 PAC NA B_39296 B_39648 B_39648 NA NA PAC PAC NA B_66903 NA NA NA PACa NA B_66903 NA NA NA PACa NA PAC NA PROSA z-score (best model) z-Score after Align-2D...
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred to Immobilon-P ... HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ Small bold letters refer to the...