a content analysis of the language used by offenders detected attempting to solicit children for sex
Analysis of colloquial language used in conversation in the textbook streamline english departures
... I Language and culture Language 1.1 What is language? A language is system of signs (symbols) for encoding and decoding information Since language became an object of study by the ancient grammarians, ... English language, has also been investigated and studied by many linguists In fact, there are many problems for the learners of English as an international language Among them colloquialism causes a ... grammarians, the term has had many and different definitions Language has a setting -the people that speak it belong to a race or a number or a race that is group that is set off by physical characteristic...
- 60
- 669
- 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... findings for the analysis We also resort to a series of related articles and news analysis in English to ensure an all-rounded analysis on the issue The websites we turn to are the International Herald ... 17 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysis of data 3.1.1 Lexical choice By referring ... remaining a bold leader, the use of formality proves to be a must in presidential speeches The 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining...
- 44
- 578
- 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC ... TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA Change Change Change Change Change Change Change Change Change Change Change Change Derivatives of pRG–his–KisKid, ... binding data, a Levene statistical was used for acceptance of variance equality One-way ANOVA and Bonferroni analyses were used to evaluate the data to a 95% level of statistical significance Protein...
- 14
- 477
- 0
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders ... not decrease linear to the wave force on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio ... Due to the interaction of the cylinders, the run-up profiles of the cylinders are quite different from that of an isolated cylinder This numerical computation method will be used broadly for analysis...
- 29
- 422
- 0
Báo cáo y học: "A descriptive report of management strategies used by chiropractors, as reviewed by a single independent chiropractic consultant in the Australian workers compensation system" ppsx
... to treatment or a lack of understanding that the goal of management was for the return to "pre-injury status" and not the complete absence of pain or for "maintenance" therapy An arbitrary rating ... than as a therapy that is a component part of a multimodal approach to management preferred by many [5,6] It seems apparent that there is a need for a change of attitude in some practitioners and ... contacted by an insurer to perform a review of the management of a claimant currently seeing a chiropractor for treatment of an occupational injury Upon contact, the ICC is informed of the type of...
- 8
- 336
- 0
A sociolinguistic analysis of the bilingual approach to the teaching of chinese language in singapore
... groups and it is also a language of wider communication Besides the official languages, other Malay languages of Indonesian origin, various Chinese dialects and South Asian ethnic languages are also ... Culture Languages that are accorded the status of ‘mother tongue’ are automatically languages of culture and identity and they are languages of “good values” (Bokhorst-Heng, 199 9a: 240) On the other ... For example, there are no archetypical Singaporean native speakers of any language in Singapore Therefore, Singaporeans often hesitate to identify themselves as native speakers of any language, ...
- 202
- 437
- 0
A bourdieuvian analysis of the use of singlish by youths in singapore
... to the age range of 19 to 25 years to eliminate age as a variable Another reason for the focus on youths is to gain insight into the direction of change, if any, with regard to the usage of Singlish ... one form of capital to be converted into another Chapter discusses the varying advantages associated with different languages; these advantages are precisely the different forms of capital (ranging ... speakers are able to command a range of styles from SSE to the colloquial variety; they are capable of using English in a broad range of functional contexts and are able to command a formal style...
- 126
- 912
- 0
A text analysis of “the 2007 commencement speech by bill gates at harvard university ” and “the 2014 commencement speech by bill and melinda gates at stanford university” on the de beaugrande framework
... initiated the post-war European Aid Program commonly known as The Marshall Plan General Marshall was awarded the Nobel Peace Prize in 1953 for his role as architect and advocate of the Marshall ... usually a short and simple summary of what have been said Recommendations can be made and the speaker would thank the audience at the end You graduates are coming of age in an amazing time As ... man in the street to reach a clear appraisement of the situation It is virtually impossible at this distance to grasp at all the real significance of the situation.‖ Thirty years after Marshall...
- 71
- 603
- 0
A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities
... websites for this study are a totally authentic source of data, not invented examples, the quality of the data is quite reliable These data are not out -of- date (from the year 2000 to 2011) Additionally, ... identified as the way in which the parts of something are arranged, and the layout of a graduation speech is the way in which the writer arranges and organizes the parts or ideas in the discourse of the ... especially Graduation speeches is more important The aim of the graduation speech is to congratulate and encourage graduates for the result they have achieved and encourage them to use the knowledge...
- 13
- 839
- 2
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese
... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... not least, Vietnamese is a tonal language The arrangement of six tones has great influence on the intonation and accent of Vietnamese Intonation exists in every language But Vietnamese intonation ... with other verbs to create verb phrases in the sentence 1.4 Contrastive analysis (CA) As one of the main aims of this paper is to carry out a contrastive analysis on the meanings expressed via the...
- 56
- 2,601
- 19
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... phase contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... prepared as described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell ... at each phase of the cell cycle were estimated from their DNA content histograms after drug treatment Apoptosis was quantified and Fig Effects of daunorubicin and WP631 on the survival of Jurkat...
- 7
- 581
- 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... 4—Carbon Sequestration Potential by Region (based on carbon price of $34/MT CO2e) Pacific Mountain Delta States South East Afforestation from cropland Appalachia Afforestation from pasture Great ... are unable to make a direct comparison of the magnitude of the net revenue from the offsets market and the estimated income loss due to higher input costs EPA has conducted its own analysis of ... regional model of the U.S agricultural sector, Lewandrowski et al examined the potential for carbon sequestration at various carbon prices At a carbon price of $34 per MT CO2e , they estimate that...
- 13
- 651
- 0
Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt
... participates in other signaling pathways, including the ataxia talangiectasia mutated ⁄ ataxia telangiectasia and Rad-3-related (ATM ⁄ ATR) pathway [32], but its targets remain to be identified ... fractions, further indicating that they are associated Regulation of PP2Ac activity by TIPRL a4 has been characterized as a regulator of type 2A phosphatases [7–9] The finding that TIPRL interacts ... in yeast Tap42 and type 2A phosphatases are key players in the TOR pathway [19], the role of a4 and PP2Ac in the mammalian rapamycin-sensitive pathway remains controversial [7,8,9,14,25,28] To...
- 14
- 418
- 0
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf
... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, the analysis with small packages is similar to the case when the firm only offers ... pay a premium to the firms to help them consume less It is profitable for the firms to offer small packages only if the prices that they are able to charge for the small packages compensate for the ... requires that the per-unit margins from the small package are at least twice as large as the per-unit margins from the large package In this paper, we have assumed for simplicity that the marginal costs...
- 16
- 488
- 0
Báo cáo khoa học: "CONTEXT-FRKFNESS OF THE LANGUAGE ACCEPTED BY MARCUS'''' PARSER" pdf
... roots and of a maximum height h In the general case, th/s information is in the form of a forest rather than a pair of trees, because we also need to account for the unattached subtrees that reside ... bringing the input tokens into the buffer for examination by the parser In Marcus' parser input tokens come to the attention of parser as they are needed Therefore we can assume that when a rule ... (6) (7) Activate packetsl; [deactivate packets2] Deactivate packets1; [a~ vate packets2] Attach ith; [deactivate packetsl]: [activate packets2] [Deactivate packetsl]: create node; activate packets2...
- 6
- 303
- 0
analysis of the astronomers wife by kay boyle
... it, for the world to function The "Astronomer's Wife" is an excellent short story that brings out the often forgottenpoint that both the practical people and the ambitious dreamers are important ... important for eachother's survival While Mrs Ames perhaps could never get along without her husband, itwas no fault of her own that she didn't She provided a comfortable existance for the astronomer ... so that he would be free to his work, and the marriage would have been happier if Mr Ames recognized all that she had done, and had considered her lifestyle avalid one Of course an understanding...
- 2
- 525
- 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx
... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments ... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... HIV/AIDS The largest category, which accounts for 86 per cent of total allocation to the Ministry of Health and Social Welfare, is for the activities of the Swaziland National AIDS Programme These...
- 63
- 312
- 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog ... sensitive traffic and that allow an active attacker remarkable leverage At the root of many of the most important practical vulnerabilities in P25 systems are a number of fundamentally weak cryptographic, ... Most of these channels are unused in any given geographic area The individual channels used by each given agency are assigned on a region -by- region basis, so a channel used by, say, the National...
- 16
- 1,185
- 0
Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx
... increased their state sales tax rate Arizona, Arkansas, California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” ... wealthiest family at the same marginal rate as the poorest wage earner Arizona and Alabama have a graduated rate structure, however there is little difference between the bottom marginal rate and ... lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax fairness — for...
- 135
- 1,516
- 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
... exchange for a share of the appreciated value of the collateral property The share of the appreciated value is determined and due at the sale of the property or at the termination of the mortgage ... dollar liquidity operations by other central banks, raising the total cap to $620 billion (up to $30 billion by the Bank of Canada, $80 billion by the Bank of England, $120 billion by the Bank of ... goal of revitalizing regions and finding new ways to generate capital for people with original ideas By creating ways to spread the benefits of human, financial, and social capital to as many...
- 51
- 467
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25