a comparative study in an iranian petrochemical plant by using simulated process data
lexical reiteration in the language of ict product advertisements a comparative study in english and vietnamese = lặp từ vựng trong ngôn ngữ quảng cáo sản phẩm công nghệ thông tin và truyền thông
... Figure 1: Advantages and disadvantages of means of advertising 1.2.2 Features of advertising language Advertisers use various linguistic means at their disposal to attract target audience‟s attention ... designed by Hanumanth, a user interface designer at Singapore-based Hewlett-Packard impressed the audience by the image of a man taking a nap in a hammock on the beach, having nothing to worry about ... explore advertising language in general and that of ICT product advertisements in particular Leech (1966) examines standard advertising language in his research “English in Advertising: A Linguistic...
- 55
- 679
- 0
Lexical reiteration in the language of ICT product advertisements A comparative study in English and Vietnamese
... (1966) English in advertising: A Linguistic Study of Advertising in Great Britain (English Language Series) London: Longman Lord and Thomas (1900) The Book of Advertising Tests Chicago and New York ... Rhetorical Structures in the Language of Vietnamese Advertisements, Asian Social Science (2010, (11), 175-182) 11 Maximum PC magazine, February 2008, USA: Future US, Inc 12 McLuhan, M (1964).Understanding ... Discourse of Advertising, London: Routledge Dyer G (1982) Advertising as Communication London: Routledge Halliday, M A K., and Hasan, R (1976) Cohesion in English London: Longman Hatim, B & Mason, I...
- 7
- 432
- 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... culture and PCR The data were compared with available clinical information Radiological data was available from 61 subjects The study was conducted blind The purpose of this study was to determine ... 365406 Dar L, Sharma SK, Bhanu NV, Broor S, Chakraborty M, Pande JN, Seth P Diagnosis of pulmonary tuberculosis by polymerase chain reaction for MPB64 gene: an evaluation in a blind study Indian J ... less than 48 hours whereas results for culture were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of...
- 8
- 524
- 0
A computational study of chiral separation of tryptophan by using cyclodextrin
... Zhongqiao, Dr Fan Yanping, Li Jianguo, Sivashangari Gnanasambandam, Dhawal Shah, Ramakrishnan Vigneshwar, Babarao Ravichandar, Babarao Ravichandar, and Chen Yifei Last but not least, I want to thank ... first approved as a racemate A company can get a patent on an individual enantiomer in this way [10] One example is the case of citalopram (Figure 1.1), which is an antidepressant medication and ... to produce enantimerically pure substances in both analytical and preparative scales, they have a main drawback in that they can only be operated in batch processes Instead, membrane technologies...
- 76
- 423
- 0
THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY
... participant is the Sayer the participant saying, telling, stating, informing, asking, demanding, offering, threatening, suggesting and so on, The Sayer can be a human or human-like speaker, and also ... types Halliday and Matthiessen investigated MOOD in English, Japanese, Chinese, and some South East Asian languages (Thai, Vietnamese, Indonesian, and Korean) and they came to conclusion that, at ... plays three different functional roles It realizes three types of meaning: a meaning about the reality (an experiential meaning), a meaning about the interaction (an interpersonal meaning) and...
- 59
- 1,140
- 13
A comparative study of insults in vietnamese and american english
... being female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as ... insulting than sarcasms With the data of insults filmed at an American recruit training base in 1980 Culpeper [9] found that impoliteness was deployed by the sergeants in a systematic way as part ... expressives, and declarations 6 2.1.3 Face Face is something that is emotionally invested, and that can be lost, maintained, or enhanced, and must be constantly attended to in interaction [5, p.61] Negative...
- 26
- 1,460
- 1
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... cannot say an animal is a cat By contrast, it is accurate to say that a cat is an animal That is, the meaning of animal is included in the meaning of cat, as in dog, lion, monkey and elephant Slightly ... newspaper article as an illustration: Headline ISAF: killed in U.S aircraft crash in Afghanistan Lead (CNN) A U.S aircraft crashed in southern Afghanistan, killing three U.S service members and ... and said that 30 Americans had been killed Answer: ISAF: killed in U.S aircraft crash in Afghanistan (CNN) A U.S aircraft crashed in southern Afghanistan, killing three U.S service members and...
- 73
- 1,661
- 4
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... [28] and rainbow trout retina [29] If molecular conservation of PtdIns is found in marine fish, what mechanisms operate to accumulate arachidonic acid into PtdIns in an environment in which arachidonic ... yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase activities ... activities are involved in the process in yellowtail Materials and methods Materials Yellowtails (S quinqueradiata) were obtained from a local market Standard fatty acids were purchased from Serdary...
- 8
- 619
- 0
Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt
... pseudo-first-order rate constant lobs for cyanide binding to Mt-trHbN(III) (squares) and Mt-trHbO(III) (circles) on ligand concentration (i.e cyanide concentration) The analysis of data for cyanide binding to ... cyanide derivative of Mt-trHbN(III) (Protein Data Bank code: 1RTE [18]), Mt-trHbO(III) (Protein Data Bank code: 1NGH [51]), and Cj-trHbP(III) (Protein Data Bank code: 2IG3 [16]), displaying part ... ðð½cyanide þ K þ [trHb(II)]Þ2 À  ½cyanide  ½trHb(II)ÞÞ= ð2  ½trHb(II)Þ ð11Þ Data analysis Data analysis was performed with the program matlab 7.0 (MathWorks Inc., South Natick, MA, USA) All...
- 13
- 366
- 0
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt
... additional full-text annotation dataset We randomly extracted 10% of the dataset for testing, and used the remainder (90%) for training Performance was measured by micro- and macro-averaged F1 (Chang ... discriminative reranking In Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, pages 173–180 Mihai Surdeanu, Sanda Harabagiu, John Williams, and Paul Aarseth 2003 Using ... 19: Frame semantic struc5 There were two participants that performed whole SRL in SemEval-2007 Bejan and Hathaway (2007) evaluated role classification accuracy separately for the training data 26...
- 9
- 549
- 0
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx
... Canadian Hansards task This task contains the proceedings of the Canadian parliament, which are kept by law in both French and English About million parallel sentences of this bilingual data ... constraints as a bilingual grammar as, e.g., in (Wu, 1997) For the baseline ITG constraints, the resulting grammar is: A → [AA] | AA | f /e | f / | /e Here, [AA] denotes a monotone concatenation and ... extended ITG constraints, the coverage increases by about 8% absolute For the Canadian Hansards task, the baseline ITG constraints yield a worse coverage than the IBM constraints Especially for the...
- 8
- 410
- 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf
... and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack of an appropriate tool ... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... and remote sensing has been using in several types of works in both government and private agencies As we know, GIS and remote sensing have an important role in linkage and analysis of such data, ...
- 24
- 897
- 0
A comparative study on rejecting invitation in English and Vietnamese
... speech acts in general, invitation and rejecting invitation in English and Vietnamese in particular Chapter II gives the ways of rejecting invitation in English and Vietnamese and the differences and ... something Accepting an invitation is a delicate matter although it is much easier than rejecting as the latter is a face – threatening act However, there are situations in which invites cannot avoid ... English and Vietnamese are quite different The collected data and analyzed data show that the understanding different ways of rejecting invitation in two cultures will help the language learner...
- 52
- 1,127
- 5
Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
... preparation A decrease in specific activity was always accompanied by an increase in signal intensity, suggesting that the g ¼ 2.01 signal is an artifact arising from an oxidatively damaged cluster ... which included a detailed comparison with the Mo-containing nitrogenase from the same organism, showed that: (a) the Fe nitrogenase components can indeed be isolated and purified as intact and catalytically ... broad signal with an absorption-shaped peak at g ¼ 2.27 and a derivative-shaped feature at g ¼ 2.06 (in the following termed g ¼ 2.27 signal) The two signals are depicted in spectra and of Fig and...
- 12
- 748
- 0
Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx
... Each participant was registered in a form of inclusion and agreed to participate by signing a Term of Free and Informed Consent Database development and statistical analysis were performed using ... with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of HIV/AIDS coinfection in the period (Santos et al., 2005) The average ... Table Mean value and percentage of cells in sputum samples of HIV-positive and -negative individuals Table Mean value and percentage of cells in sputum samples according to the radiological patterns...
- 7
- 392
- 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... (2008) Kinetoplastids: related protozoan pathogens, different diseases J Clin Invest 118, 13011310 Fairlamb AH (2002) Metabolic pathway analysis in trypanosomes and malaria parasites Philos Trans ... Western blot analyses of trypanosomatid cell extracts Polyclonal antisera against L major GLO1 were raised in adult male Wistar rats An initial injection of 100 lg of puried antigen, emulsied in complete ... maintain an intact glyoxalase system, and may metabolize methylglyoxal via methylglyoxal reductase (MeGR) and lactaldehyde dehydrogenase (LADH) to L-lactate Solid lines: conrmed metabolism in...
- 11
- 639
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... Cys35Ala R-TDPX1 Cys35Ala F-TDPX1 Cys64Ala R-TDPX1 Cys64Ala F-TDPX1 Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ... Aliquots (2 lg per lane) were separated by SDS PAGE and stained with Coomassie Brilliant Blue: lanes and 2, TDPX1 wild-type; lanes and 4, TDPX1 Cys35Ala; lanes and 6, TDPX1 Cys83Ala; lanes and ... ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTG GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTC GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC...
- 16
- 483
- 0
party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007
... Sotsial-Demokratychna Partiya Ukrainy (Ob”ednana) (Social Democratic Party of Ukraine - United) Ukrains’ka Natsional’na Asambleya (Ukrainian National Assembly) Ukrains’ka Natsional’na Samooborona (Ukrainian ... Randazzo, Kerry Fraas, Jim Saunders, Ben Long, Anna Bartosiewicz, Ryan O’Donnell, Gabe Fabian, Dom Ionta, Halyna Kohan, Maria Semikoz and Bohdan Malnev for their research support and assistance ... Savienrba (Latvian Christian Democratic Union) Latvijas Nacionglg Neatkarrbas Kustrba (Latvian National Independence Movement) Latvijas Sociglistiskg Partija (Latvian Socialist Party) Latvijas...
- 279
- 751
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose