a combined genetics and biochemical approach to explore the functional interactions between sphingolipids and sterols in biological membranes
Novel lipidomic approaches to analyse glycerophospholipids and sphingolipids in complex mixtures using mass spectrometry
... collaborating and the expertise in animal work To all my other collaborators, thank you for the interest, the enthusiasm, and the opportunities to learn about many amazing things beyond the scope ... 77 Chapter A Combined Genetics and Biochemical Approach to Explore the Functional Interactions between Sphingolipids and Sterols in Biological Membranes 80 4.1 Introduction ... Schaad O, Kajiwara K, Wakabayashi H, Ivanova T, Castillon GA, Piccolis M, Abe F, Loewith R, Funato K, Wenk MR and Riezman H Functional interactions between sphingolipids and sterols regulating...
- 225
- 1,280
- 0
Báo cáo khoa học: The biochemical properties of the mitochondrial thiamine pyrophosphate carrier from Drosophila melanogaster ppt
... sense 5¢-AGGCATGATACTAAATGCCAT TGAA-3¢ and antisense 5¢-TCCAGAACTGACAAATGC CGTAC-3¢; CG6608-RB, sense 5¢-GTGGAGCATGATAC TTAAATGCCA-3¢, and antisense 5¢-TCCAGAACTGACA AATGCCGTAC-3¢; CG2857-RA, sense ... 5¢-CTCTTCTACA AGTACCTCAACGCGG-3¢ and antisense 5¢-TTCTCCCA AGATACTAATGCTTGCC-3¢; Rp49, sense 5¢-ATGACC ATCCGCCCAGCATACA-3¢ and antisense 5¢-TTGGTG AGGCGGACCGACAG-3¢ The PCR products were analysed ... Iacopetta et al cytosol for the activity of transketolase, and in the mitochondria for the activity of pyruvate-, oxoglutarate- and branched chain keto acid dehydrogenases To our knowledge, in...
- 10
- 300
- 0
Báo cáo sinh học: " Imaging with isotopes: high resolution and quantitation" potx
... tracers and the calculations, etc And the software development was the other essential part The limiting parameter has become not the machine but the ability to analyze the reams of data that ... were in place, the remaining challenge was developing the functional software and computational know-how to analyze all the data Each image pixel has an intensity that is a function of the number ... nuclear reactor I became interested in using isotopes as tracers and studied transport across cell membranes using electron probe microanalysis There was a man there called Georges Slodzian who was...
- 5
- 231
- 0
Adiponectin in cattle profiling of molecular weight patterns in different body fluids at different physiological states and assessment of adiponectin’s effects on lymphocytes
... AdipoQ binds to the N-terminal extracellular domain, whereas the intracellular C terminal domain binds to APPL1 (an adaptor protein containing a pleckstrin homology domain, a phosphotyrosine binding ... receptor and AF allantoic fluid AMPK adenosine monophosphate-activated protein kinase APPL1 adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper ... is the dominating hormone in ruminants (Flint and Knight, 1997); it increases the blood flow in mammary glands and has blood glucose-elevating effects Prolactin increases the intestinal uptake...
- 131
- 350
- 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... 5¢-CAGCGTGACATAACTGTTAAA GGGCATGGCCCA-3¢ R105H-fwd: 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT TTTTAGC-3¢ R105K-fwd: 5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢ ... amino acid is the main reason for the increase in Km values The point mutation probably does not alter the backbone conformation of the Ca-atoms In conclusion, the kinetic and structural data ... the base, was mutated to N in order to see how the increased distance between the base and substrate-binding amino acid affected the binding of dThd and deoxycytidine (dCyd) Results Fig Binding...
- 10
- 504
- 0
Báo cáo khoa học: Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase doc
... the NAs, thereby trapping them inside the cell This is regarded as the rate-limiting step and makes the deoxynucleoside kinases important actors in combating malignant cells One approach in this ... with substrates and a feedback inhibitor [12,13] It has a structure similar to that of the human dGK and dCK and belongs to a structural family that also contains some viral thymidine kinases (TKs) ... 6) The guanosine base is in the syn-conformation, in contrast to the thymine and cytosine bases that are in the anticonformation in those complexes There is a water molecule bridging ⁄ anchoring...
- 10
- 308
- 0
South Africa''''s role in conflict resolution and peacemaking in Africa docx
... Backed by his East African allies, Uganda and Rwanda, as well as Angola, he overran Kinshasa in May 1997 and pushed Mobutu into exile South Africa’s peace diplomacy was put to the test again as ... INTRODUCTION Senegal and Mauritania, and between Senegal and Guinea-Bissau; crises in Guinea-Conakry and Guinea-Bissau; and internationalised civil wars in Sierra Leone and Liberia ECOWAS, or coalitions ... other African states, especially as South African corporates and parastatals drive deeper into the continent, it remains the case that South Africa’s selfinterest appears to be increasingly aligned...
- 280
- 506
- 0
Báo cáo hóa học: "Retention of progenitor cell phenotype in otospheres from guinea pig and mouse cochlea" ppt
... neonatal mouse and guinea pig, and to evaluate the guinea pig as a potential cochlea donor for preclinical cell therapy Methods The experimental protocol was previously approved by the Internal ... functional analysis of precursor, support and hair cells Arq Int Otorrinolaringol 2007, 11:433-437 16 Albuquerque AA, Rossato M, Oliveira JA, Hyppolito MA: Understanding the anatomy of ears from guinea ... and dissociation After bathing the animals in absolute ethanol, they were decapitated and had the temporal bones removed and Page of 10 maintained in Leibovitz’s L-15 medium (Sigma-Aldrich, St...
- 10
- 476
- 1
báo cáo khoa học: " Variation at four enzyme loci in natural populations Drosophila melanogaster : factor analyses of genotypic and gametic associations Angeles ALONSO-MORAGA" pdf
... obtained from each individual In our case the individuals are the populations, and the variables are the genotypic and gametic frequencies II Material and methods Two wine cellar populations and ... first axis contains points overall than the negative one, and all the points involving a- Gpdh For s z lAdh F Est-6/-, the gametes carrying the Est-6allele and the Est-6 and Est-6 s la-Gpdh F gametes ... frequency analysis (fig 1) was the third eigenvalue also greater than (k, 1.33) The explained variance for each axis is also indicated in these figures, and the cumulative percentage varies between...
- 10
- 229
- 0
evolution of credit and banks in france, from the founding of the bank of france to the present time
... monopoly of the Bank of France as a bank of issue The latter owed this advantage to the ability of its administrators, to the lack of cooperation among the departmental banks, and, finally, to the tendency ... revolutionized a t that time certain industries, as, for example, the manufacture of artificial soda, the improvements in the paper industry, and, finally, mechanical inventions for spinning and weaving-all ... had been counting on, it appealed to the Government to take its affairs in hand and offered to give the Minister of Finance a statement a In 1767 an attempt was made to found a bank of issue to...
- 136
- 1,041
- 0
báo cáo khoa học: "Genomic profiling of plastid DNA variation in the Mediterranean olive tree" pdf
... seven main cpDNA lineages in the O europaea complex (for the olive tree classification see [16]): lineage E1 was detected in the Mediterranean area and Saharan Mountains, lineages E2 and E3 were ... specific to the Western Mediterranean area, lineage M was only detected in Macaronesia, lineages C1 and C2 were observed from Southern Asia to Eastern Africa, and lineage A was characteristic ... detected in wild olives than in cultivars, and this allowed some population genetic analyses, for instance in the laperrinei and guanchica subspecies from Saharan Mountains and Canary Islands, respectively...
- 12
- 581
- 0
Báo cáo y học: " Global expression profiling of theophylline response genes in macrophages: evidence of airway anti-inflammatory regulation" ppsx
... F495: GGAATACCAGTCCCGACACTAACT R587: GGCCTTCTCTAAAGATGTTTTCACA F44: GGCTATTTGAAGTCGCCATAACC R121: AGATTTAAAACCTTGATATTGCCTCTCT F414: CTCGAACCCCGAGTGACAA R477: AGCTGCCCCTCAGCTTGA F1200: AACACACACTCGCGTTGCAA ... (5'→3') a IL-5 F180: ATAGCCAATGAGACTCTGAGGATTC R268: AGTGTGCCTATTCCCTGAAAGAT F155: TGAGGAGCTGGTCAACATCA R230: CAGGTTGATGCTCCATACCAT F211: GCTGAACCAGTAGAAGACAATTGC R304: CCAGGTTTCATCATCTTCAGCTA F495: ... AACACACACTCGCGTTGCAA R1268: CGGCTTGTCACATCTGCAAGT F1193: AGATGCCTGGCTCAGGAAGA R1266: ATGTCATGGAATCCATCTGTTGAGT F119: GCCCTGGGAGCATGTGAA R196: TTCATCTCAGCAGCAGTGTCTCTA F852: CACGAACCACGGCACTGATT R940:...
- 12
- 237
- 0
Báo cáo khoa học: Regulation of calpain B from Drosophila melanogaster by phosphorylation pot
... N-terminal regulatory domain (I), a catalytic domain (II), a C2-like domain (III) and a calmodulin-like calcium binding domain (IV) The main difference between mammalian and Drosophila calpains ... we monitored the disappearance of the 104 kDa intact calpain B band as a function of time (Fig 5A) and used the same kinetic approach as applied before for the determination of the apparent first-order ... (aiming to avoid unwanted autoproteolytic degradation during sample handling) by replacing Cys314 with Ala in the active center of the enzyme The active calpain B and the inactive C31 4A mutant were...
- 14
- 314
- 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc
... using proctolin (40 lM) as the substrate SDS/PAGE analysis of fractions containing partially purified DPP activitiy revealed two major bands in the range of 82 and 86 kDa in both cytosolic and ... Fukasawa (Matsumoto Dental University, Nagano, Japan) The anti-(rat liver DPP III) was prepared as described by Fukasawa et al [2] Goat anti-rabbit Ig with peroxidase labelling was from Boehringer-Mannheim ... proctolin degrading activity, a dipeptidyl aminopeptidase activity was shown to hydrolyse proctolin in insects and was referred as to mammalian DPP III [11] but this was not further investigated...
- 9
- 357
- 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx
... reagents (Amersham Pharmacia Biotech, Piscataway, NJ) Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits ... were separated by 12.5% SDS ⁄ PAGE and blotted with anti-Flag serum The 30 kDa protein band of Flag-tagged DmPCNA2 and the 36 kDa protein band of Flag-tagged DmPCNA1 are indicated by arrows The sizes ... regions, an interdomain connecting loop and a C-terminal tail DmPCNA2 formed homotrimers and associated with DNA polymerase d and DNA polymerase e in vivo In addition, DmPCNA2, as well as DmPCNA1, was...
- 12
- 404
- 0
Báo cáo y học: "Comparison of marker gene expression in chondrocytes from patients receiving autologous chondrocyte transplantation versus osteoarthritis patients" pptx
... Up:5'-ATGGCAGAAGTACCTAAGCTCGC Low:5'-ACACAAATTGCATGGTGAAGTCAGTT ALK-1 Up: 5'-CGGCTCCCTCTACGACTTTCT Low: 5'-CAGCACTCCCGCATCATCT GAPDH Up: 5'-TGAAGGTCGGAGTCAACGGATTTGGT Low: 5'-CATGTGGGCCATGAGGTCCACCAC ... and II collagen (CI and CII, respectively), aggrecan (AGG), IL-1β and activin-like kinase (ALK)-1 as indicated The mRNA levels were normalized to GAPDH and amplified by a factor of 106 The ratio ... conditions and exposure to catabolic stimulators (IL-1 and retinoic acid) on the expression of matrix metalloproteinases (MMPs) and disintegrin metalloproteinases (ADAMs) by articular cartilage chondrocytes...
- 10
- 523
- 0
Báo cáo y học: " Protocol for investigating genetic determinants of posttraumatic stress disorder in women from the Nurses'''' Health Study II" pot
... constraints The above model can be easily specified in PLINK In summary, given a strong initial association signal, these analyses can help to determine which variants are causal and which are ... genes and makes a more stringent assumption regarding population homogeneity) or the more traditional case-control approach Comparing this approach to the standard pairwise SNP-by-SNP approach ... be interviewed) will be missing from the final sample used in data analysis as will participants with incomplete data on analytic variables Ultimately, we want the parameter estimates in our final...
- 20
- 326
- 0
Báo cáo y học: " Viral particles of the endogenous retrovirus ZAM from Drosophila melanogaster use a pre-existing " potx
... of the follicle cells In any case, secretory granules and their associated yolk proteins are important factors in controlling the release of viral particles from the Golgi apparatus and targeting ... targeting them toward the apical pole of the follicle cells A parallel can be made between these data and a study performed on a mammalian retrovirus: the murine leukaemia virus (MLV) [2] Indeed, Basyuk ... uptake There is now abundant evidence in the literature to indicate that retroviral Gag proteins interact with a variety of proteins involved in these pathways Analysis of the role played by the Gag...
- 9
- 188
- 0
A discourse analysis of urban water management in singapore from 1960 2009
... on the small island, and Singapore’s capacity to support the rapidly expanding population was pushed to its natural limit (Jayakumar 1988).6 Drinking water supply on the island was fast being ... A stringent and meticulous process was involved in the collecting, collating, organizing, coding and analyzing of these archival data (Mason 2002) In the earliest stage, collection of data was ... that has been legitimated to control and manage the flow of urban water One way of gaining an insight into governance in Singapore is to examine the way the state has discursively engaged the population...
- 156
- 603
- 0
Consuming more than just water a discourse analysis of urban water management in singapore from 1960 2009
... on the small island, and Singapore’s capacity to support the rapidly expanding population was pushed to its natural limit (Jayakumar 1988).6 Drinking water supply on the island was fast being ... A stringent and meticulous process was involved in the collecting, collating, organizing, coding and analyzing of these archival data (Mason 2002) In the earliest stage, collection of data was ... that has been legitimated to control and manage the flow of urban water One way of gaining an insight into governance in Singapore is to examine the way the state has discursively engaged the population...
- 156
- 669
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25