a class has access to private members of all objects of the class
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases ... proximity of the C-terminal helix to catalytically important residues is strongly suggestive of a role in Vps4 ATPase activity In addition, other members of the meiotic clade of AAA ATPases that Vps4...
- 23
- 490
- 0
How to get out of the friendzone: turn your friendship into a relationship
... each other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, ... him Then he met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started ... look at him again Tiana doesn’t know what she’ll if Laura and James get together She longs for the day when James gets a job at another company, because maybe then she could work up the courage to...
- 240
- 1,057
- 1
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
... timeconsuming at best and impossible at worst, if there is no gold standard available Luckily, the Bayesian approach allows us to automatically select values for the hyperparameters by treating them as additional ... 1996) to resample the value of each hyperparameter after each iteration of the Gibbs sampler Informally, to update the value of hyperparameter α, we sample a proposed new value α′ from a normal ... hyperparameters to encourage some degree of sparsity in all clusters Conclusion In this paper, we have demonstrated that, for a standard trigram HMM, taking a Bayesian approach to POS tagging dramatically...
- 8
- 523
- 0
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx
... In the absence of a clinical evaluation, a simulator was developed to simulate 70 days of data and test the ability of the system to store large amounts of data and to manipulate these data to ... BT Laboratories If an alarming situation was detected, an automated call was made to the monitored home The monitored subject could indicate that there was no problem by answering the call and ... continually monitors the user’s activity patterns in their home by forwarding data from the wrist unit to the base station The base station generates an automated alarm if an alarming period of inactivity...
- 17
- 603
- 1
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt
... demonstrated for the E coli DnaE OB domain [12,16] The very N-terminal region of PolC and the C-terminal domain of DnaE appear to be specific for each type of polymerase The small a ⁄ b C-terminal ... structures of PolIIIs-V and DnaA-I adopt a variant of the so-called type II KH fold [21] One of their major differences from classical type II KH domains is the absence of the characteristic GXXG motif ... and Lys41 In addition, species of the class Bacilli often have one to four Lys or Arg residues in variable positions of the N-terminal part of the a1 helix These residues also contribute to an...
- 10
- 419
- 0
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf
... well as model the adjacent output labels The additional features we introduced are: • the distance to the next same word and the next same POS tag • a binary feature to indicate if there is a filled ... with that of the first ranked candidate This is because we try to avoid a very large or small compression ratio, and the first candidate is generally a good candidate with reasonable length • The ... discriminative training to rerank the candidates generated in the first step Reranking has been used in many tasks to find better global solutions, such as machine translation (Wang et al., 2007), parsing...
- 5
- 425
- 1
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx
... 5¢-GGACATCTCCTTCGGCTT-3¢ 5¢-AGTGACCAGCACAGATAGC-3¢ 5¢-GTGGATCCAGTGTTCGTCAT-3¢ 5¢-CCGTGCCCATCGTGTCTGA-3¢ 5¢-CCAGTAGACAAACCACTTCG-3¢ 5¢-CATACCTGGCTTCAAGATGC-3¢ 5¢-CAGGAATTGCCGATAGGATGC-3¢ 5¢-TACTTGCGTTCAGGGGGAGC-3¢ ... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... lobster Panulirus argus MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA KSLILCVLLAGAFA KSLVLCLLLAGAFA KSLVLCLLLAGAFA MKTLVFCLLLVGALA APSGKPKFRRGLNK APSGKPKFRRGLNK APSGKPKFRRGLNK APSGKPKFRRGLNK...
- 13
- 474
- 0
Báo cáo sinh học: " Research Article A Gaussian Mixture Approach to Blind Equalization of Block-Oriented Wireless Communications Frederic Lehmann (EURASIP Member)" doc
... is a short all- one vector of length equal to the channel memory, used to set the final ISI state of the current data burst to a known value At the same time, this also sets the initial ISI state ... denotes the dimension of the continuous valued state variable Proof In (31), the term p(sk , xk , y1:k ) has been calculated as (21) and the integral, also appearing in (25), has already been ... Differential encoding of the transmitted data is used to solve the phase ambiguity problem Also, a length10 known preamble is used to resolve the delay ambiguity The lengths of the CMA and FCF equalizers...
- 10
- 267
- 0
Báo cáo hóa học: " Research Article A Unified Approach to BER Analysis of Synchronous Downlink CDMA Systems with Random " doc
... , and m is the Nakagami-m fading i α parameter We have used the Nakagami-m fading model since it can represent a wide range of multipath channels via the m parameter For instance, the Nakagami-m ... a one -to- one mapping between the parameter m and the Rician K factor allows the Nakagami-m distribution to closely approximate Rician fading distribution [9] As the fading parameter m tends to ... Lilliefors test The Lilliefors test [20] evaluates the hypothesis that data has a normal distribution with unspecified mean and variance against the alternative data that does not have a normal distribution...
- 12
- 360
- 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory ... facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of annual ... strata, the non-participation of the two providers was unlikely to have introduced a large amount of bias Finally, our data reflect only the care and/or diagnosis information included in the...
- 7
- 337
- 0
báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx
... data analysis and drafted the manuscript CS conducted data analysis and helped to draft the manuscript LP participated in study design, data collection and analysis, and helped to draft the manuscript ... implementation and the value added to the organization by the EHR Participants’ recommendations may help healthcare administrators anticipate barriers to EHR implementation and work to address them, ... implementation Limitations Because we base our findings on experiences within the VA, they are most applicable to large managed care systems and may be less applicable to small healthcare organizations...
- 8
- 249
- 0
báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt
... "satisfied." Performance of the Canadian C-Spine Rule Performance of the Canadian C-Spine Rule will be evaluated by the following measures Accuracy of the rule: The classification performance of the rule ... as to what is the safest way to manage each individual patient We note that Canadian physicians are already selective in ordering C-spine radiography, and omitted radiography for 28.3% of cases ... and "after" periods Secondary analyses will compare the "after" and "decay" periods in order to evaluate sustainability For the analysis of dichotomous data from this matchedpair design, a parametric...
- 14
- 217
- 0
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc
... Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A, Hara T, Enomoto T, Sasaki S, Kawai M, Hamasaki N, Shirakawa T, Hopkin JM, Izuhara K: Cutting edge: dominant effect of Ile50Val ... this was a cross-sectional study in which participants had radiographs performed after various durations of RA Severity was not calculated on the basis of the rate of accumulation of joint damage ... Yamada A, Takami M, Kawawa T, Yasuhara R, Zhao B, Mochizuki A, Miyamoto Y, Eto T, Yasuda H, Nakamichi Y, Kim N, Katagiri T, Suda T, Kamijo R: Interleukin-4 inhibition of osteoclast differentiation...
- 9
- 472
- 0
Báo cáo y học: "Clinical and Molecular Allergy: a new open access journal that addresses rapidly evolving information in the field of allergy and immunology" pptx
... treatment of allergic and immunological disease and the molecular biology of inflammatory cells, cytokines, and other factors Mini reviews, commentaries and editorials will be systematically and periodically ... new and Open Access publication We hope that you will support us by submitting your manuscripts to the Journal Information is available at the following URL: http:// www.clinicalmolecularallergy.com/manuscript/ ... Clinical and Molecular Allergy 2004, http://www.clinicalmolecularallergy.com/content/2/1/1 will also be highly sought We will publish novel and innovative articles related to both the clinical treatment...
- 2
- 248
- 0
Actual situation study, some factors has risk to infect larva of toxocara canis in human and effect of treatment by albendazole at 2 commune of an nhon district, binh dinh province (2011 2012)
... Morbidity rate of larvae of Toxocara canis in rural areas is higher than that in urban areas (4.4% against 1.6%) The study of Kaplan and et at has represented 2.6 % healthy people having Toxocara canis ... block of toxocariasis 1.2.1.1 Agents cause toxocariasis - Agents cause disease: Agents cause disease of Toxocara canis is Toxocara canis - Morphology of Toxocara canis: size of males 4-10 cm and ... cm and females 6-18 cm Toxocara canis belong to of: Branch: Nematoda, Group: Phasmida; Kind: Ascaridoidea; Race: Toxocara; Specied: Toxocara canis 1.2.1.2 Biological cycle of Toxocara canis - In...
- 24
- 407
- 0
Assessment on the access to and utilization of legal services by ethnic minority women
... wholehearted thanks to Department of Labor, Invalids and Social Affairs of Bac Kan and An Giang provinces for coordination with different local stakeholders, organization and facilitation of the ... build the capacity of national and provincial duty bearers so that they can better implement the two Laws as well as monitor, evaluate and report on their implementation The Programme has the following ... to collect information and data to advocate for gender equality policy for marginalized and disadvantaged groups in the society The study on situation of the access to and utilization of legal...
- 78
- 223
- 0
Before designing, check out the party! Here’s how to transform a dull layout into an energetic expression of the real event.
... fun! is a character line set to match the dates and times; the two similar blocks now “bookend” the main copy Colored black, the small Kentucky Mine Amphitheater gains strength against the larger ... Where’s the party? The black hat hints at the country-western theme of the summer concerts, but nothing’s happening; the lines are too straight, the type is too static and the space is too empty to ... like they’ve been around since the gold rush And to really crowd the room, the headline typeface must be massive Poplar Standard Black Fat body, stubby arm What goes with brown? Analogous (adjacent)...
- 18
- 336
- 0
How to translate some of the metaphors in Harry potter Books (book 3 and book 7) into Vietnamese
... how to translate some of metaphors in Harry Potter and the Prisoner of Azkaban and Harry Potter and the Deathly Hallows not a boring task of reading, analyzing and comparing but actually a great ... the work of a translator have been discussed Accordingly what is the competence required to be a professional translator? Newmark (1995) assumes that a translator has to have a flair and a feel ... Translator II.1.2.2.1 What is a translator? It is not the truth that a person knowing at least a foreign language could be a translator That a language learner may be proficient at that language...
- 45
- 1,222
- 5
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
... upscale customers Finally, one Japanese supermarket, Seibu, has positioned itself as the top quality supplier for the upper end of the market and tries to present an international image (Kawahara ... the customer Once customers find a retailer they trust, they are very likely to return again and again to that same retailer Generally, it takes a long time for a retailer to develop a reputation ... Philippines; Macro is in Thailand and Taiwan, Carrefour from France is in Taiwan; and Wellcome is in Taiwan, Hong Kong, Mainland China and Singapore Major Japanese department stores are in most Asian cities...
- 51
- 1,039
- 3
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25