a chorus line of interviews by type
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
... hypophosphatasia, (b) infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are ... hypophosphatasia Eur J Med Genet 50, 367–378 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated tissue-nonspecific ... Molecular basis of perinatal form of hypophosphatasia N Numa et al Hypophosphatasia is caused by various mutations of the tissue-nonspecific alkaline phosphatase (TNSALP) gene (EC 3.1.3.1)...
- 11
- 500
- 0
Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx
... divergence and radiation of the six eukaryotic supergroups (Excavata, Plantae, Chromalveolata, Rhizaria, Amoebozoa and Opisthokonts)? As sophisticated bioinformatics approaches have failed to detect any ... elongation factor 1alpha Proc Natl Acad Sci USA 101, 15380– 15385 124 Andersson JO, Sarchfield SW & Roger AJ (2005) Gene transfers from Nanoarchaeota to an ancestor of diplomonads and parabasalids Mol ... diplomonads and parabasalids belong to the earliest diverging eukaryotic lineage [46,47,58] – comparative interrogations of various morphological and molecular character traits, as well as phylogenies...
- 18
- 419
- 0
A SIMPLE EXPLANATION OF MONEY By Isuru Abeysinghe potx
... have a half-chicken and an apple, Jane would have an axe and a half-chicken and Peter would have an axe and a cup It’s getting complicated – and there are only three people involved! Additionally, ... of that, nobody will trade today, because between Adam and Jane (and also between Jane and Peter) there are no items of barter that each party is happy with Now, we are all thinking the same thing: ... Roman days, and in pre-colonial India, salt was used as currency: because it was universally useful Because salt was the only preservative available, everybody needed it to be able to store meat...
- 4
- 227
- 0
A contrastive analysis of apologizing by english and vietnamese speakers
... of an apology, acknowledgement of responsibility, an offer to repair, an explanation or account of the situation and a promise of forbearance After that, Blum-Kulka and Olshtain (1984) rearranged ... 3.2 3.1 Apology data analysis by situation As it was stated that the aim of this study was to investigate the speech act realization used by a large number of English and Vietnamese teachers working ... offended want to offer an apology, it means they express their goal of humiliating the partner In this situation, an apology is regarded as a face-threatening act for the speaker and a face-saving act...
- 84
- 931
- 7
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... Aliverti A, Zanetti G, Arakaki AK, Ottado J, Orellano EG, Calcaterra NB, Ceccarelli EA, Carrillo N & Karplus PA (1999) A productive NADP+ binding mode of ferredoxin-NADP+ reductase revealed by ... the NADP+ oxidation reaction is highly regiospecific Kinetics of NADPO formation as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation to NADPO catalyzed by FprA or AdR...
- 10
- 406
- 0
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
... proteins ELISA Figure (A) The map of dominant immunoreactive areas of ORF2 The amino acid residues of each area are identified (B) The ORF2 fragment that spans from amino acid 113 to 147 was amplified ... positive sera by GST-ORF2-E ELISA A negative-positive threshold for each assay was calculated using the Microsoft Excel spreadsheet Evaluation of assay repeatability Ten negative serum samples and 10 ... ELISA showed repeatability for negative sera as indicted by the low variability among replicates from the same sample There was smaller differences between intra-assay trials than inter-assay...
- 7
- 420
- 0
Báo cáo y học: " Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro" pdf
... 3000 7G (Affymetrix) GeneSpring GX 11 (Agilent) was used for the normalization, filtering and statistical data analysis of the Affymetrix microarray data The linear data was first summarized using ... for further GO and pathway analysis GO and pathway over-representation analysis as well as further analysis of protein-protein interactions and transcription factor regulation were carried out using ... software for pathway analysis of statistically significant genes Real-time quantitative RT-PCR assays Total RNA was isolated using the RNeasy Mini kit (Qiagen) as described The cDNA was synthesized...
- 9
- 359
- 0
Báo cáo y học: "Nociceptive tolerance is improved by bradykinin receptor B1 antagonism and joint morphology is protected by both endothelin type A and bradykinin receptor B1 antagonism in a surgical model of osteoarthritis" pdf
... design diagrams for static weight bearing apparatus Labels in French Auto-drafted using CATIA V5 R19 PDF file named static weight bearing apparatus design diagrams.pdf (4 pages) Kaufman et al Arthritis ... Figure Antagonist treatment improves radiological indices of OA: MR results (a) No surgery and saline treatment; (b) sham surgery and saline treatment; (c) ACLT and saline treatment; (d) ACLT and ... protective As well, cartilage T2, increased in ACLT animals, was decreased by antagonist treatment, which indicates a cartilage-preserving effect Longer cartilage transverse relaxation times are an indicator...
- 11
- 378
- 0
Tỷ lệ bồi thường theo nghiệp vụ của toàn thị trường loss ratio by line of insurance
... chính/Credit & financial risk Insurance BH tài sản thiệt hại/Property & Casualty Insurance Bao gồm/Including BH XDLĐ/Car & EAR insurance BH máy móc thiết bị/Machinary breakdown insurance BH thiết ... DOANH THU PHÍ BẢO HIỂM C A TOÀN THỊ TRƯỜNG INSURANCE PREMIUM INCOME BY LINE OF INSURANCE tháng 2009 TT Nghiệp vụ bảo hiểm lines of Insurance BH sức khỏe tai nạn người/ Personal Accident,Heath ... tài sản thiệt hại/Property & Casualty Insurance Bao gồm/Including 2,087,964 215,604 30,504 BH XDLĐ/Car & EAR insurance BH máy móc thiết bị/Machinary breakdown insurance 1,113,396 53,432 151,531...
- 5
- 660
- 2
A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation
... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even ... Hakoda M., Shimbara S., Nagaoka H., Chung Y and Hamada A (1994) Active oxygen species generated during chlorination and ozonation Water Sci Technol., 30, 91-99 Utsumi H., Han S.K and Ichikawa ... elementary reactions and k1 and k2 indicate the apparent rate constants, respectively Similarly, in this study, it still remains unclear what reactions in the cascade are affected by resorcinol and...
- 7
- 569
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...
- 9
- 522
- 0
Ecological Assessment of Water Quality by Three-species Acute Toxicity Test and GC/MS Analysis - A Case Study of Agricultural Drains
... to quantify the ecotoxicity level of river water from an urban area in Japan and agricultural drains when agricultural chemicals are applied In addition, analysis of agricultural chemicals by GC/MS ... tests as indicators of decontamination in composting oily waste, Ecotoxicol Environ Saf., 47, 156-166 Liu R., Kameya T., Sawai A and Urano K (2007) Application of a larval medaka assay to evaluate ... Sagami Bay Fig - Location of sampling sites (Kanagawa Prefecture, Japan) Preparation of Samples for Analysis All water samples were filtrated using a μm glass fiber filter, and then concentrated...
- 8
- 667
- 0
Types Of Interviews
... in a professional environment and applicants should conduct themselves accordingly Casually asking about the interviewer’s hockey puck on his desk is okay but describing the wacky events at the ... Conversational interview These are most closely related to the traditional style of interviewing They appear to be in a more comfortable, relaxed setting but not be fooled, these meetings are still ... the interviewer’s hockey puck on his desk is okay but describing the wacky events at the last game you attended, is not ...
- 2
- 402
- 0
a discourse analysis of opening and closing speeches by masters of ceremonyon reality television showsin american english versus vietnames
... Use of Informal Language in AOSs and VOSs Based on the data, a large number of vocabularies used in AOSs are informal contractions and slangs Contraction is defined by Oxford Advanced Learner ... lexical and grammatical cohesion based on Halliday and Hasan’s points of view The number of each type will be counted and followed by its frequency Secondly, ACSs and VCSs were analyzed at the same ... such as a conversation, a poster.” Halliday and Hassan (1976) viewed “Text” as a “semantic unit” characterized by cohesion or a framework that is logical and general They used discourse to explain...
- 145
- 794
- 0
A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities
... example (4.73) We can try to build walls around us, and we can look inward, and we can respond by being frightened and angry about those disruptions [5] In grammar, parallelism is a balance of ... similar words, phrases, or clauses As shown in the above example, in (4.73) parallel structures are made up at clause level At lower level of parallel, word balancing with word appears popularly: ... DISCUSSIONS 4.1 LAYOUT FEATURES OF ENGLISH GRADUATION SPEECHES Layout is identified as the way in which the parts of something are arranged, and the layout of a graduation speech is the way in which...
- 13
- 839
- 2
A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA
... General Features of Oscar Acceptance Speeches 2.2.8.1 Acceptance Speech as a Type of Discourse 2.2.8.2 Notions of Acceptance Speech An acceptance speech is a speech delivered on accepting some award ... has made a great contribution to art /science/politics/etc.[62] 2.2.8.3.Some Notes on the Oscar Wikipedia cites “An Academy Award, also known as the Oscar, is granted by the American Academy of ... conversation analysis by Cook[9], speech events and contextual analysis by Hatch [23] cohesion by Halliday and Hassan [20], etc To the best of my knowledge, although there have been many researches...
- 13
- 851
- 1
A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh
... War II was in the final stage World War II was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists ... the assertion about the independence of Vietnam because saying that Vietnam had ceased to be a French colony means that Vietnam was not a French colony any more 24 By means of the verb of change ... effect of what he speaks On the contrary, the writer has the advantage of taking more time in choosing lexis and organizing ideas He can rearrange what has been written and make changes if he wants...
- 47
- 1,467
- 8
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... exclusively to female humans and animals Eg: Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia Lioness (Noun): a female lion ... morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot be further analyzed This definition may be too ... of plants and animals) “GRAM” – (It means “written”): telegram (a message sent by telegraph and then printed and given to somebody), grammar (the rules in a language for changing the form of...
- 63
- 988
- 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition
... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive ... figure and its minimum cutsets for output node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied...
- 6
- 545
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25