a central factor in the pathophysiology of frailty
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... isolated from the brains of infected animals (Figure 3B) in the absence of significant increases in levels of this viral sensor in total brain protein isolates (Figure 3A) Finally, we assessed the ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the...
- 12
- 529
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi...
- 10
- 427
- 0
Focus - A simplicity manifesto in the Age of Distraction
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what ... were insulted or indignant, either feeling like I was insulting their way of doing things, or that I was some kind of prima donna or “diva” for not wanting to be available through email Interesting:...
- 121
- 552
- 1
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There...
- 7
- 322
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...
- 16
- 438
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of...
- 12
- 386
- 0
Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx
... nuclear material was scattered in the ooplasm indicating spindle damage Statistical analysis Data for meiotic development of oocytes among all groups was analyzed by chi square procedure using Statistix ... Physiology, Department of Animal Science, University of Minnesota, Saint Paul, USA and Dr Muhammad Aleem Bhatti, Associate Professor, Department of Theriogenology, University of Veterinary and Animal Sciences, ... 647-653 Chauhan MS, Katiyar PK, Madan ML In vitro production of blastocyst in goats, sheep and buffaloes Indian J Anim Sci 1997, 65, 394-396 Chauhan MS, Singla SK, Palta P, Manik RS, Madan ML In vitro...
- 5
- 370
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... 95 Arthritis Research & Therapy Vol No Haringman and Tak The data from studies with chemokine antagonists in humans are at present not very comprehensive However, the initial data are promising...
- 5
- 460
- 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... Available online http://arthritis-research.com/content/7/1/44 cellular activation (also known as transformation), that leads to alteration in their apoptotic response, the attachment of these ... destruction Although a number of molecular pathways have been identified that contribute to the stable activation of RASFs, the precise cause and nature of this activation, as well as its relevance and ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and...
- 3
- 222
- 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was ... that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated by the arrow, although the staining was...
- 8
- 335
- 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt
... FAM – AGG GGT CCT GGC TGC CTT CCT CTT C – TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA ... for each passage, and cumulative population doublings were calculated At each passage, an aliquot of approximately × 106 cells was taken for analysis of MTL, and regression analysis and Spearman ... PDAR PDAR PDAR 99.65% P16INK 4a 5' GGC TCT ACA CAA GCT TCC TTT CC 3' 5' FAM – CCC CCA CCC TGG CTC TGA CCA – TAMRA 5' TCA TGA CCT GCC AGA GAG AAC A 3' 99.22% MMP-13 5' CCC CAG GCA TCA CCA TTC AAG...
- 12
- 617
- 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx
... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... vascular anastomosis taking place after the migration of the primordial germ cells to the site of the primitive gonad had finished, a mechanism which has been previously suggested to explain the ... 100 fetal calf serum, p 100 phytohemaglutinin M (Difco), 100 LU of penicillin and 100 mg/ml of streptomycin The metaphases were conventionally stained in Giemsa and 15 analysed for each animal III...
- 5
- 319
- 0
Báo cáo y học: "urgical correction of unsuccessful derotational humeral osteotomy in obstetric brachial plexus palsy: Evidence of the significance of scapular deformity in the pathophysiology of the medial rotation contracture" ppt
... humeral head at its greatest diameter The distance of the scapular line to the anterior portion of the head and the greatest diameter of the humeral head were measured The ratio of these distances ... of the humerus within the glenoid fossa The abnormal migration of the scapula disrupts the normal anatomic relationships of the humeral head, the glenoid fossa and the acromio-clavicular triangle ... superomedial angle of the scapula was enacted Finally, the extremity was splinted in adduction, 5° of external rotation and full forearm supination (90°) Splinting was maintained for weeks after...
- 7
- 369
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious ... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... shown in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...
- 7
- 393
- 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal...
- 4
- 342
- 0
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... has no competing interests Published: 27 April 2011 References Takei S, Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa ... activity; the activation and release of IL-18 by the in ammasome as a marker of innate immunity; and the alternatively spliced soluble IL-18Rβ, which is mainly expressed in the lymphoid organs and ... Interestingly, IL-18 protein expression in synovial tissue did correlate with serum CRP and disease activity in inflammatory arthritis [12], indicating a local role in the pathophysiology of disease A...
- 3
- 294
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible ... particularly so as the current major markets for asthma therapeutics are industrialized nations such as the USA, western Europe, and Australia [2], all of which have substantially and increasingly admixed ... differences in histamine metabolism might contribute to the response to therapy in asthma [145] Confirmation of these findings could mark the beginning of the clinical use of genotyping at an individual...
- 11
- 491
- 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps
... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration of therapy ... treatment of ARDS and larger trials are in progress The appropriate timing of steroid therapy needs to be clarified Steroids have been advocated for the late immunemediated phase of the disease, although ... Obias-Manno D, Barker AH, Arensberg D, Baker A, Friedman L, Greene HL, Huther ML, and the CAST investigators: Mortality and morbidity in patients receiving encainide, flecainide, or placebo The...
- 3
- 355
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25