a brief history of computer music languages and systems the synergy between technology and creativity
Light sheet based fluorescence correlation and cross correlation spectroscopy for quantitative measurements of bio molecules in live cells
... Ma Xiaoxiao, Wang Xi, Nirmalya Bag, Sun Guangyu, Angela Koh, Huang Shuangru, Sibel Yavas, Andreas Karampatzakis, Shi Hua Teo, Shiying Lim, Patrick Kramer, Kaijie Herbert Fan, and Kumaravel Kandaswamy ... And special thanks to SPIM users Antonija, Adam, Angela, Xuewen, Andreas, and Kumar I would like to acknowledge nancial, academic and technical support from department of chemistry and center ... levels of my academic career, thanks a lot for your constant help and support To all my friends, Ajay, Anuradha, Debanjan, Jasmine, Kuldeep, Rahul, Subha, Veer Bhadur, Zubair and many more for their...
- 135
- 606
- 0
Tài liệu ANSYS Mechanical- A Powerful Nonlinear Simulation Tool pdf
... also made available Anand’s model uses an internal scalar variable called the deformation resistance to represent the isotropic resistance to the inelastic flow of the material, and is thus able ... solver such as the AMG (Algebraic Multi Grid) equation is a particular strength of the ANSYS Mechanical program Moreover, the calculation can take advantage of parallel processing in a shared memory ... troubleshooting tools ANSYS offered contact analysis features as early as Release 2.0, and then evolved the state of the art according to advancing analysis needs Table provides a summary of that evolution...
- 39
- 591
- 3
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx
... ANOVA The effect of the amino acid supplement on egg ␦13C was tested in the 1998 data set with ANOVA, including sugar type, day, and the interaction between sugar and amino acids as effects The ... standard deviation of carbon standards combusted, distilled, and analyzed together with samples was 0.028‰ 13 Egg protein composition and ovarian dynamics The elemental composition of five batches ... the two years ␦13C of larval and adult dietary components Samples of larval host plant (including V labrusca, V novae-angliae, and A brevipedunculata from several collection sites) ranged in ␦13C...
- 10
- 434
- 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... division is between East and West The border between these two areas goes around Pleven and Teteven, and it is the border of “yat” realization as presented in the traditional dialectological atlases ... Multidimensional scaling is data analysis technique that provides a spatial display of the data revealing relationships between the instances in the data set (Davison, 1992) On both the maps the biggest ... structure of the dialect divisions It is an important step towards more general investigation of the role of the regular sound changes in the language dialect variation The main drawback of the method...
- 6
- 651
- 0
Tài liệu Báo cáo khoa học: "a Computer-Aided Summarisation Tool" docx
... comparison of the output of a summarisation method with a gold standard which is specified by the user The quality of the summary is computed in terms of precision and recall The drawback of such ... the help of the tool in a random order After a period of at least months has lapsed so that any effect of familiarity is extinguished, subjects will be asked to produce the same summaries again ... who can transform the extract into an abstract As not all sentences identified automatically are worth including in a summary, the user has the option to override the program's decisions and...
- 4
- 496
- 0
Báo cáo khoa học: "a bilingual dictionary generating tool" potx
... human or a machine, expects all translations to be accurate We evaluated 2000 randomly selected Japanese entries from the initial translation candidates, scoring all Hungarian translations as correct ... dictionary Our method maintains the recall value of the initial translation candidates, owing to the bidirectional selection method with local thresholds However, the recall value of a manually created ... translation in the intermediate (i) language We consider each such source-target pair a translation candidate Next we eliminate erroneous candidates We examine the translation candidates one by...
- 4
- 325
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine ... the town of Grande Isle to the town of Hamlin The two areas were delineated as the research site because they are areas that contain all four of the data sources The surface area is approximately...
- 131
- 599
- 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... principle of the two-step evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator ... propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm is the sampling step An episode of this ... impose the constraint that any transformed part of the source sentence cannot be transformed anymore This paradigm is more approriate for paraphrase generation than the standard SMT approach in...
- 4
- 338
- 0
Đề tài " A quantitative version of the idempotent theorem in harmonic analysis " docx
... Annals of Mathematics, 168 (2008), 1025–1054 A quantitative version of the idempotent theorem in harmonic analysis By Ben Green* and Tom Sanders Abstract Suppose that G is a locally compact abelian ... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A + A| K |A| An analogue of this theorem for any ... suppose that there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and...
- 31
- 523
- 0
Báo cáo khoa học: "Multilingual adaptations of ANNIE, a reusable information extraction tool" doc
... capability to display text and the ability to enter text in other languages than the default one It also provides a means of entering text in a variety of languages and scripts, using virtual ... An online demo of ANNIE is available at http://gate.ac.uk /a, nnie/index.jsp A set of movies demonstrating document and corpus loading, processing and storing, manual annotation of documents and ... has been adapted to IE in Bulgarian, Romanian, Bengali, Greek, Spanish, Swedish, German, Italian, and French, and we are currently porting it to Arabic, Chinese and Russian, as part of the MUSE...
- 4
- 216
- 0
Antibody response to influenza vaccination in the elderly: A quantitative review doc
... Primary factor of interest: age of study participants 2.5 Statistical analysis We selected all papers that reported data on groups of subjects with a mean age of 65 and over From these papers, ... contrast, GMT was given in the original papers as a mean estimate for each sub-study and confidence intervals were rarely available Therefore, we could not calculate a summary estimate for GMTs that ... with a mean age above or below 75, as a best proxy for age In univariate and multivariate analysis, there was a significantly lower response in those over 75 years of age, suggesting that Ab response...
- 11
- 484
- 0
eDiscovery Project Management: Guidance On Developing A Methodology And Documentary Tools docx
... Obtain an inventory of presently available Active Media (e.g., servers and desktops in use) and Passive Media (e.g., backups such as tapes and DVDs) Create additional backups of Active Media as ... national law firm IT managers and savvy litigators, seeking to gain an edge in electronic discovery Born in India, Mr Shingala was a National Merit Scholar and a graduate of the prestigious National ... Documentary Tools during a particular period See the Appendix for an example of a path name/file name report that illustrates how path names and file names alone may arguably reveal potentially...
- 24
- 447
- 0
Báo cáo khoa học: The heat shock protein 70 molecular chaperone network in the pancreatic endoplasmic reticulum ) a quantitative approach potx
... presence of ATP Each BiP application was followed by application of running buffer The analysis was carried out employing the BIA evaluation software version 2.2.4 (BIACORE) Steady-state ATPase assay ... 11432–11443 Eki T, Naitou M, Hagiwara H, Ozawa M, Sasanuma SI, Sasanuma M, Tsuchiya Y, Shibata T, Hanaoka F & Murakami Y (1996) Analysis of a 36.2 kb DNA sequence including the right telomere of chromosome ... mammalian microsomes Thus, lack of interchangeability between BiP and Kar2p at the level of the Hsp40s ERj1 and ERj2 and at the level of the nucleotide exchange factor Grp170 does not appear to...
- 13
- 429
- 0
Báo cáo khoa học: Protein transport into canine pancreatic microsomes A quantitative approach potx
... SRP-dependent manner and cotranslationally, yeast prepro -a- factor (Fig 2D, bars and vs and 2), and a precursor that is transported predominantly in an SRPdependent manner and cotranslationally when ... that in these mammalian microsomes the concentration of SR, rather than the concentrations of the translocase subunits Sec62p and Sec63p, may be the decisive factor for the ratio between the two ... of all samples (including the luciferase translation reaction) were subjected to SDS/PAGE (19.4% acrylamide + urea) and phosphorimager analysis The quantification of ppl86mer was carried out as...
- 8
- 382
- 0
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot
... current speaker and the gender of the other speaker These categories are symbolized with two letters: the first characterizing the gender of the current speaker and the second the gender of the other ... question is whether the high classification accuracies can be attributed to a small number of features or are rather the cumulative effect of a high number of them In Table we apply the two feature selection ... each other At the beginning of each conversation a topic is suggested at random from a list of 40 The latest release of the Fisher collection has more than 16 000 telephone conversations averaging...
- 8
- 347
- 0
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... comparisons of quantitative variables was in most cases straightforward, and always at least plausible The analysis of the linguistic tests and their combinations has also led to a computational method ... automatically extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method We apply statistical tests ... We have presented a quantitative analysis of the performance of measurable linguistic tests for the selection of the semantically unmarked term out of a pair of antonymous adjectives The analysis...
- 8
- 442
- 0
báo cáo hóa học:" CRP identifies homeostatic immune oscillations in cancer patients: a potential treatment targeting tool?" pdf
... with advanced melanoma (Adelaide) From the serial CRP data-points a 'standard CRP curve' was mathematically derived patients The periodicity of days for this cycle appears reasonably stable and ... colorectal adenoma and cancer patients Clin Chem Lab Med 2008, 46(10):1423-8 Sawamura M, Yamaguchi S, Murakami H, Kitahara T, Itoh K, Maehara T, Kawada E, Matsushima T, Tamura J, Naruse T: Cyclic haemopoiesis ... have examined L-CRP in the serum of patients with advanced melanoma and ovarian cancer, measured serially 1-2 days apart, and identified an apparent 'cycle' in the CRP levels Serial L-CRP measurements...
- 8
- 376
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 ... tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa ... gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al Journal of Translational Medicine 2010, 8:2 http://www.translational-medicine.com/content/8/1/2 Basal...
- 9
- 568
- 0
Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt
... management support AL and MN completed the analysis of the SAHA data MM assisted with the data analysis and participated in drafting and editing of the manuscript SL completed the analysis of ... analysis of the protocol selection study, participated in the analysis of the SAHA data and participated in the drafting and editing of the manuscript All authors read and approved the final manuscript ... expression of thousands of genes [9,12,13] Another challenge is that the specificity and sensitivity of a given RNA profiling platform are affected by the abundance and variability of the globin transcripts,...
- 12
- 585
- 0
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx
... dramatically Adequate preparation in primary and secondary education becomes even more crucial in the preparation of a good supply of eligible and qualified applicants We also assume the MOH has ... to the labour market also have the potential to alter the government's ability to hire and retain graduates Moreover, we caution that these estimates of workforce need are made at the national ... of Zambia called for an increase in current training enrolment by over 90% across all cadres In May and June of 2008, the Government of Zambia and the Clinton Foundation assessed all 39 of Zambia's...
- 10
- 427
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose