a biosocial approach for explaining the two peaks of early antisocial behavior
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
... on the SiNWs modified Ag(1 0) surface Two filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape ... to the structure proposed by Sahaf et al [2] and (b) side view of the PQ/SiNWs adsorption mechanism responsible for the shrinkage of the gap For the same reason, the onset of the feature appearing ... of the LDOS of the SiNWs and that of the adsorbed PQ aggregates Therefore, the contribution of the LDOS of the SiNWs at the proximity of the Fermi level is presumably Fig STM filled states images...
- 5
- 465
- 0
A Generic QSAR for Assessing the Bioaccumulation Potential of Organic Chemicals in Aquatic Food Webs pot
... Jon A Arnot and Frank A P C Gobas (ii) the parameterization of the model to reflect Canadian conditions and (iii) the calibration of the model to a large BCF and BAF database The resulting QSAR ... transformation, field derived BAF data are subject to several other environmental and analytical factors that could produce low BAFs BAF-QSAR application: Areas of application of the BAF-QSAR ... hydrocarbons (PAHs) For this class of chemical substances a reasonable database exists that can be used for calibration Also, similar mechanisms for metabolic transformation may apply to this class of chemical...
- 9
- 717
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as ... 10.1186/1479-5876-8-51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R ... performed as described above for the human blood assay The pilot work for the assay was performed on the Human Immune TLDA (ABI), which contains assays measuring the levels of 96 different Arai et al...
- 13
- 528
- 0
Báo cáo hóa học: " Research Article A Two-Stage Approach for Improving the Convergence of Least-Mean-Square Adaptive Decision-Feedback Equalizers in the Presence of Severe " doc
... This validates the analysis performed in Section 5.3 It is also seen that the performance of the systems improves as the number of filter taps is increased, approaching the performance of QPSK The ... associated data symbols that can not be canceled by the feedback taps For the special case of K = M, it can be seen that if the data fed back is perfect, the ISI caused by the feedforward equalizer ... Decision-feedback equalizer K z−1 wDFE,l = The DFE is composed of a transversal feedforward filter with K + 1-taps (one main tap and K side taps) and a feedback filter that has M-taps A block diagram of the...
- 13
- 365
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... farm level Such veterinarians are motivated to collect valid data at the herd level They perceive the collection of the data in and of itself as the basis for taking relevant action at the farm ... should clearly be improved before analysing the data on national level Causal analysis of cow-level and herd-level risk factors for metritis at the national level based on Danish central data base ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters...
- 10
- 587
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... commercial banks in the two economic areas However, this may abstract from the fact that in the US a large part of …nancial intermediation is not registered on the balance sheets of commercial banks ... see also Angeloni, Kashyap and Mojon (2003) for early euro area evidence Moreover, Gambacorta and Mistrulli (2004) and Altunbas et al (2004) provide evidence of the importance of bank capital...
- 30
- 911
- 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...
- 9
- 356
- 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf
... Nonliteral precision and recall are defined similarly Average precision is the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of ... of average precision and average recall We calculated two baselines for each word The first was a simple majority-rules baseline Due to the imbalance of literal and nonliteral examples, this baseline ... algorithm and then determine the effects of each enhancement The results are shown in Figure The last column in the graph shows the average across all the target verbs On average, the basic TroFi algorithm...
- 8
- 447
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... purposed the assessment of the migration capacity of the cells At the moment there is no consensus in establishing acceptance criteria for the migration capacity of BM-MNC in cardiac regeneration ... invalid value, based on acceptance criteria, was observed in the first run for the 1:10 dilution The results of the validation assay are reported in Table Page of (page number not for citation ... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 of the European Parliament and of the Council of 13 November 2007 on advanced therapy...
- 9
- 773
- 0
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt
... performance of the feedback (aiming for the ideal form) rather than the performance of the movement itself For example, the participant may move faster to achieve a faster musical speed because ... components and the user interacts with the movement of the abstract animated components The image that is animated may be familiar, but the user only sees the image at the beginning of the action (establishing ... multiple actions are completed Aggregate data visualizations, such as summaries of patient performance across ten reaches, can facilitate overall assessment and comparison of performance across multiple...
- 15
- 608
- 0
Báo cáo toán học: "A Differential Approach for Bounding the Index of Graphs under Perturbations" ppsx
... set of its eigenvalues in the complex plane The spectral radius is the maximum of the modulus of its eigenvalues If the matrix is the adjacency matrix of a graph, we call it the index of the graph ... modifies a graph into another, we denote by GI the initial graph and by GF the final graph Similarly, if AI and AF are the adjacency matrices of the graphs GI and GF on n vertices, we say that AF is ... is a regular graph P roof Let n + be the order of graphs GI and GF with adjacency matrices AI and AF , respectively In the language of perturbations, we can consider that AI and AF are related...
- 13
- 212
- 0
báo cáo khoa học: "Use of 3D-computed tomography angiography for planning the surgical removal of pineal region meningiomas using Poppen''''s approach: a report of ten cases and a literature review" pptx
... Currently, the infratentorial supracerebellar (Krause’s) approach, occipital transtentorial (Poppen’s) approach and the combination of both approaches are commonly used Krause’s approach is essentially ... Krause’s approach alone This alternative treatment is applicable to certain large and giant tumors of the pineal area As demonstrated in their study, the combined approach was successful in the ... while four had a KPS score
- 8
- 434
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein ... Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for ... 21:434-439 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile...
- 7
- 384
- 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... The mainstay of surgical therapy in primary or metastatic disease is to achieve a complete resection with negative margins [7] Conventional chemotherapy and radiation therapy may have minor adjunctive ... of Cajal [1] They affect mostly males between the ages of 50 and 70, and are usually found incidentally at early stages [1-4] Large or advanced lesions may present with a variety of clinical findings, ... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional...
- 4
- 454
- 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... http://genomebiology.com/2010/11/8/R86 are examples of metadata) - to repeat an analysis exactly When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step Galaxy’s metadata includes ... genomic research Galaxy tags are hierarchical and can have values, and these features make tags amenable to many different metadata vocabularies and navigational techniques For instance, the tag encode.cell_line ... computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers can communicate all components of an...
- 13
- 400
- 0
báo cáo khoa học: " Pyrosequencing, a method approved to detect the two major EGFR mutations for anti EGFR therapy in NSCLC" ppt
... 65:7276-7282 Tanaka T, Nagai Y, Miyazawa H, Koyama N, Matsuoka S, Sutani A, Huqun , Udagawa K, Murayama Y, Nagata M, Shimizu Y, Ikebuchi K, Kanazawa M, Kobayashi K, Hagiwara K: Reliability of the peptide ... sequence reaction 5’-CATGTGGCACCATCTCACAAT-3’ 5’GCTGCGAGCTCACCCAGAATGTCTGG-3’ 62°C 5’-GAATTCGGATGCAGAGCTTCTT-3’ 5’-Biotin-CCCACA CAGCAA AGCAGAAACT-3’ 5’-Biotin-CTTTCTCTTCCGCACCCA 5’-TAAAATTCCCGTCGC-3’ ... cancer: analysis of results in 19 patients Int J Clin Oncol 2008, 13:442-446 Nagai Y, Miyazawa H, Huqun , Tanaka T, Udagawa K, Kato M, Fukuyama S, Yokote A, Kobayashi K, Kanazawa M, Hagiwara...
- 7
- 360
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+ ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases, ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment...
- 11
- 469
- 0
Báo cáo y học: "Use of the float-moor-crush approach for subtotal mid-segment collapse of a protruding aorto-ostial vein graft stent: a case report" pps
... ostium was performed Unfortunately, the engagement was unsuccessful and the procedure was aborted Another conservative approach was proposed and a PCI of the native left main and left circumflex artery ... Santa Clara, CA, USA) was used to moor the catheter to the stent through a side strut (Figure 2) and further advanced the wire to the peripheral portion of the graft After a new channel was created ... (NYHA IV) A third attempt to reengage the protruding stent in the vein graft ostium was discussed and planned The protruding part of the aorta was long and pointed towards the aortic valve at an...
- 4
- 235
- 0
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx
... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... analysis, expression and purification of proteins in small format, ELISAs assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line...
- 9
- 750
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25