0

a biological explanation for the big two

Báo cáo toán học:

Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx

Báo cáo khoa học

... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers College (Natural ... 60, and 31t − 738 ≤ i ≤ 31t + 799) Now we define these Bi ’s These subgraphs all have a common vertex x, otherwise their vertex sets are pairwise disjoint For 7t+1 ≤ i ≤ t − 742, let the subgraph...
  • 6
  • 477
  • 0
Báo cáo y học:

Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot

Báo cáo khoa học

... methods for annotation; a web graphical interface (MaGe) for data visualization and exploration; and the large Prokaryotic Genome DataBase (PkDGB) for data storage, which contains more than 400 ... meliloti and Agrobacterium tumefaciens and plants such as Arabidopsis thaliana [46] Therefore, in N meningitidis and N lactamica sulfate (a) reduction differs slightly from the classical pathway since ... approximately 4,000 CDSs have thus been manually curated, bringing the grand total to approximately 6,400 (Table 4) As above, all these datasets are stored in NeisseriaScope and are readily accessible...
  • 13
  • 552
  • 0
Báo cáo y học:

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

Báo cáo khoa học

... and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, the abstract description of a digital computer as a Von ... the cell As alluded to above, the various types of RNA serve as intermediaries in the translation, access and control of the information encoded on the DNA mRNA is the intermediary data format ... servo head As the disk rotates, a new bit (flux boundary) travels across the receiving boundary area of the servo head and the data are read In the DHD, the DNA can be considered to remain relatively...
  • 29
  • 420
  • 0
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI   by   Dinh Huu Son

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

Báo cáo khoa học

... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... account-holder, authenticated by the presentation of a token (a data-bearing card) and the keying of a PIN, uses a terminal and network to authorise the transfer of value from their account to that of a merchant; ... payment card vouchers These mechanisms have various characteristics, such as the extent to which the parties are identified, the traceability of the transaction, and the taxability of the transaction...
  • 58
  • 472
  • 0
Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Tài liệu khác

... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... Addition:When adding two complex numbers, the real parts and imaginary parts are added separately, the real parts added to real parts and the imaginary to imaginary parts Thus, Copyright 2004, Industrial ... a0 = a – b = ( a – b ) ( a + ab + b ) a2 – b2 = ( a + b ) ( a – b ) ( a + b ) = a + 3a b + 3ab + b a a 3 3 3 a – b = ( a – b ) + 3ab ( a – b ) a a = a 2 a + b = ( a + b ) – 3ab ( a + b ) a b...
  • 3,340
  • 636
  • 2
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Kĩ thuật Viễn thông

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...
  • 10
  • 634
  • 1
Tài liệu

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Sức khỏe giới tính

... establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local, regional, national...
  • 22
  • 703
  • 0
Tài liệu Đề tài

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Thạc sĩ - Cao học

... [KSb] for the general case which may have DA = DB In that case we had simple random walks {S η }t≥0 with jump rate Dη for η ∈ {A, B}, and there were two paths associated with each initial particle ... A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved in [KSb] that on a certain ... same distribution at the space-time point (x + y, t + s) as the full-space process (started at (0, 0)) at the point (y, s) Again we shall use the same random walk paths A for all the full-state...
  • 67
  • 490
  • 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Điện - Điện tử

... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria are plant-cells, they must imbibe[Pg 6] their ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...
  • 201
  • 540
  • 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Kế toán - Kiểm toán

... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... difficult to obtain Recent advances in the coverage and accessibility of national data on employment and the ability to link these data to higher-education databases are starting to alleviate this condition...
  • 140
  • 391
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tiếp thị - Bán hàng

... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.")...
  • 14
  • 780
  • 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Báo cáo khoa học

... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described above Confocal microscopy and imaging...
  • 14
  • 669
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Báo cáo khoa học

... compared to h: *P < 0.05; **P < 0.01 sion number AAG09721) are located adjacently in a head-to-head orientation, and their transcription start sites are  1.5 kb apart We therefore analyzed the ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, Nakayama M, Sun J, Fujita H, Hida W et al (2003) Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene...
  • 12
  • 621
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Báo cáo khoa học

... of the same order in the same network, as was illustrated for the two examples in this paper The network outside the former subgraph may away with the oscillophoretic potential of the subgraph ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...
  • 11
  • 638
  • 0
140 CHARACTERS A Style Guide for the Short Form

140 CHARACTERS A Style Guide for the Short Form

Internet Marketing

... Minimize adverbs and articles Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also ... been operational for more than a year when management decided to create an account to represent the company itself It became apparent that a single account to transmit information to users was needed ... communication is ubiquitous and instantaneous Those same features are also the bane of the medium Interruption and distraction can appear at any time, and anywhere The weakness of short-form communication...
  • 210
  • 3,112
  • 0
Time Banks A radical manifesto for the UK ppt

Time Banks A radical manifesto for the UK ppt

Ngân hàng - Tín dụng

... Time Banks UK and their partners at the TimeBank campaign, and the idea has been hailed as a vital tool for rebuilding trust and social capital Community time banks are widely regarded as a neat ... trust and social capital when it has all but gone But they are still culpable It is their fault that they have clung too long to an old-fashioned idea of professionalism, and a dream that they ... depression – because they find that taking part in the time bank can mean real improvements The South London and Maudsley NHS Trust covers the same area specialising in mental health, and have watched...
  • 18
  • 317
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid ... the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage product of the Ab A4 precursor protein (APP)...
  • 9
  • 634
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... l-gulono-1,4-lactone [17] as substrates d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbic acid [14,18] Like yeasts, a protozoan parasite Trypanosoma brucei possesses a d-arabinono-1,4-lactone...
  • 11
  • 571
  • 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Ngân hàng - Tín dụng

... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... commercial banks in the two economic areas However, this may abstract from the fact that in the US a large part of …nancial intermediation is not registered on the balance sheets of commercial banks...
  • 30
  • 911
  • 0

Xem thêm