a bibliometric analysis of articles citing the unified theory of acceptance and use of technology
A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA
... a lot of sadness tonight because I am accepting an award at such a strange time.[65] The antonym is taken advantage of as a way to express the speaker’s thoughts and show emotions to the audience ... choice and syntactic features of EOASs? What are the discourse characteristics of EOASs in term of cohesive devices and stylistic devices? What are the implications drawn from the analysis of EOASs ... functions: - The first is used for the establishment and maintenance of human relationship (interactional use) ; - The second for the working out of and transference of information (transactional use) ...
- 13
- 851
- 1
A contrastive analysis of linguistic features of the adjective black in english and đen in vietnamese
... the adjectives Black and Đen - Giving contrastive analysis of Black and Đen in terms of frequency and semantic features 3.3 RELIABILITY AND VALIDITY Analysing and contrasting semantic and pragmatic ... a statistical package for the same tasks 11 12 CHAPTER METHODOLOGY AND PROCEDURES - Examining the pragmatic features of the adjectives Black and Đen - Giving contrastive analysis of Black and ... STUDY With the contrastive analysis of the different features of meaning of the adjective Black and Đen, pragmatic acquisition of how to apply such an adjective in appropriate and suitable ways, 1.3.2...
- 13
- 1,921
- 5
A discourse analysis of advertisements in english and vietnamese on the internet
... business? The long Island Association The long Island Association Advocacy Networking Benefits LIA Long Island Association Leading long island Learn more In (52) “LIA” was illustrated by The long Island ... RESEARCH DESIGN The thesis design was based on the combination of both descriptive and explorative approaches A contrastive analysis was conducted with English as L2 and Vietnamese as L1 3.2 DATA ... tình qua hotline”… functions This is because an educational message may be addressed to a receiver and it is associated almost with the addresser, and generally entails an attenuation of the emotive...
- 15
- 2,309
- 3
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese
... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic ... fields as well as pragmatic features of the WDBs The finding of the pragmatic features of the WDBs leads both teachers and learners of study may be in one way or another beneficial to the language ... the fact that - Syntactic and cultural features of the WDBs learners generally impose the use of their culture on that of the target - Semantic and pragmatic features of the idioms language is very...
- 13
- 1,702
- 5
A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh
... was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists were very reactionary, combative and ... imperialists abusing the standard of Liberty, Equality, and Fraternity, have violated our Fatherland and oppressed our fellow-citizens (8) They have acted contrary to the ideals of humanity and ... our political prisoners detained at Yen Bai and Cao Bang”, the President can say “they fled and then massacred a great number of our political prisoners detained at Yen Bai and Cao Bang” However,...
- 47
- 1,467
- 8
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese
... in language B” He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... conventional meanings of the modals can, may, must and has dealt with the contrastive analysis of the meanings expressed by these modal verbs and the equivalent expressions in Vietnamese The presentation ... been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the equivalent expressions in Vietnamese The analysis has shown that there occurs a few...
- 56
- 2,601
- 19
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
... sub-domains and domains and between domains and the total score were similar at baseline and endpoint The correlations for change from baseline were usually slightly smaller The RA and the PA sub-domains ... subdomains (see Tables 4, for the loadings) The factor analysis was based on baseline data only The first factor of the 12-factor solution mainly consists of items from the subdomains IRA and TA, ... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At...
- 15
- 1,153
- 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... FL, USA) at the ÔServeis Cientifico-TecnicsÕ of the University of Barcelona, using the 488 nm line of an argon laser and standard optical emission filters Percentages of cells at each phase of the ... contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline as unique ... that the relatively low uptake of WP631 was at the origin of the low apoptosis, and whether longer periods of treatment could cause significant apoptosis in the presence of this bisintercalator...
- 7
- 581
- 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... that balance supply and demand in all commodity markets simultaneously FAPSIM is calibrated to the USDA February 2009 baseline which forecasts supply, demand and price estimates to 2018 We then ... hence, putting them at significant market disadvantage The bill sets a maximum amount of allowances that can be rebated to EITE industries at, 2% for 2012 and 2013, 15% in 2014, and then declining ... cropland and pastureland and through soil management at a carbon price of $34 per CO2e Figure 4—Carbon Sequestration Potential by Region (based on carbon price of $34/MT CO2e) Pacific Mountain...
- 13
- 651
- 0
A comparative analysis of methods to represent uncertainly in estimating the cost of constructing wastew
... the literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 1987; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made ... respect to the measurement of vagueness (Bardossy, 1990; Moskowitz and Kim, 1993) and the algorithms of Group Method of Data Handling (GMDH) (Hayashi and Tanaka, 1990), the use of a two-stage construction ... Chen and N.-B Chang Table Database of all domestic wastewater treatment plants in Taiwan Location of treatment plant Hsin-Ying service area (in highway) Hai-Hu Vacation Center The Home of Charity...
- 27
- 762
- 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... measurements For the significance of the RNA binding data, a Levene statistical was used for acceptance of variance equality One-way ANOVA and Bonferroni analyses were used to evaluate the data to a 95%...
- 14
- 477
- 0
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf
... Note Small and large packages purchase small packages to reduce their total consumption and achieve a consumption pattern On the other hand, the introduction of small packages could also lead to ... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, the analysis with small packages is similar to the case when the firm only offers ... consumed at a time and the total number consumed Our assumption can be viewed as an approximation of such a convex function Jain: Marketing of Vice Goods: A Strategic Analysis of the Package Size...
- 16
- 488
- 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
- 63
- 312
- 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... sensitive traffic and that allow an active attacker remarkable leverage At the root of many of the most important practical vulnerabilities in P25 systems are a number of fundamentally weak cryptographic, ... 20ms of audio, for a total 180ms of encoded audio in each LDU frame), plus additional metadata and a small amount of piggybacked low speed data Each LDU, including headers, metadata, voice subframes, ... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog...
- 16
- 1,185
- 0
Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx
... Arizona, Arkansas, California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” law or reached an agreement with the ... are capital gains tax breaks (Arizona, Arkansas, Hawaii, Montana, New Mexico, North Dakota, South Carolina, and Vermont) and deductions for federal income taxes paid (Alabama, Iowa, Louisiana, ... State lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax...
- 135
- 1,516
- 0
A Comparative Analysis of Carbon Dioxide Emissions in Coated Paper Production Key Differences between China and the U.S. pot
... each plant relative to the total production of coated paper for China for the year By far the largest coated paper plant is the Asia Pulp and Paper (APP) facility in Dagang, China This plant alone ... According to an analysis of World Trade Atlas 2007 data, the leading producers of BSKP for China are China (36%), Canada (12%), Chile (12%), the U.S (11%), Russia (10%), Finland (4%), and New Zealand ... (Lang, 2007) Indonesian company PT Garuda Kalimantan Lestari plans a 1.2 million ton capacity pulp mill and associated chemical plant in West Kalimantan PT Kaltim Prima Pulp & Paper plans a 1.2...
- 53
- 622
- 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
... Buildup and Meltdown of the Mortgage and Credit Markets The demand for residential real estate was seemingly insatiable After rising at an average annual rate of slightly less than percent during the ... The Rise and Fall of the U.S Mortgage and Credit Markets A Comprehensive Analysis of the Meltdown James R Barth, Tong Li, Wenling Lu, Triphon Phumiwasana, and Glenn Yago January 2009 A full-length ... excess of that amount is shared by the government (90%) and Citigroup (10%) Guarantee a portion of an asset pool of loans and securities backed by residential and commercial real estate and other...
- 51
- 467
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and downregulated genes (compared with all 12 441 annotated genes) was calculated using the ... clustering analysis of AT-MSC-Hepa Unsupervised hierarchical cluster analysis was performed by sorting of 1639 altered genes (Fig 3A) This analysis of microarray data revealed a striking similarity of...
- 14
- 597
- 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
- 63
- 322
- 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx
... studied have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
- 63
- 328
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25