a b c or d before the word or phrase with the same meaning as the underlined word
Amersham RPCM Sắc ký pha đảo
... the reversed phase beads is a < /b> crucial factor in determining the available capacity for solute binding by the medium Note that this is not the capacity factor (k´) but the actual binding capacity ... acid, etc and perfluorinated organic acids such as TFA, PFPA and HFBA These acids can cause severe skin burns and inhalation of fumes should be avoided These substances should be handled with the ... factor is not the same as the available binding capacity which refers to the mass of the solute that a < /b> specified amount of medium is capable of binding under defined conditions The capacity factor,...
- 86
- 556
- 0
Báo cáo Y học: Myristyl and palmityl acylation of pI 5.1 carboxylesterase from porcine intestine and liver Tissue and subcellular distribution potx
... form (Table 3) Myristic and palmitic acids were the predominantly linked FA, while a < /b> number of minor fatty acids including stearic, oleic and arachidonic acids could also be detected It is worth ... 30 cm) and eluted with the above-mentioned buer Esterase activity on tributyrin was assayed as indicated in Materials and methods Solid and dotted lines represent the protein absorbance at 280 ... incubated at 80 C for h, and then dried under a < /b> stream of nitrogen After adding the same amount of water, the aqueous layer was acidi®ed with HCl and the free fatty acids were extracted with...
- 9
- 358
- 0
Application of Bacillus spp. Isolated from the Intestine of Black Tiger Shrimp (Penaeus monodon Fabricius) from Natural Habitat for Control Pathogenic Bacteria in Aquaculture ppt
... Pathogenic bacteria V harveyi AQVH was isolated from diseased P monodon, A < /b> hydrophila AQAH was isolated from diseased hybrid catfish and S agalactiae AQST was isolated from diseased Oreochromis ... tap water and artificial sea water A < /b> Bacillus W120 B Bacillus W803 and A < /b> hydrophila AQAH C Bacillus W806 D Bacillus W902 and S agalectiae AQST E Bacillus W1106 F Bacillus WL01 and V harveyi AQVH ... W803 against Aeromonas hydrophila after incubated Bacillus day (A)< /b> and after incubated Bacillus days (B) Table Size of clear zone of Bacillus W120 and Bacillus W803 when pre-cultured Bacillus...
- 8
- 358
- 1
Báo cáo khoa học: "Isolation of cholesterol-lowering lactic acid bacteria from human intestine for probiotic use" ppsx
... regarded LAB as Streptococcus, Lactobacillus and Bifidobacterium by aerobic growth, Gram’s stain and cell morphology All isolates were maintained on BL agar plates in the anaerobic conditions and ... Lactobacillus, were aerobically incubated at 28oC for 24 hrs on MRS agar plates, and Bifidobacterium was anaerobically incubated at 35oC for 48 hrs on BL agar plate Bacteria were preprocessed with reagents ... Lactobacillus HJL-4 Lactobacillus HJL-20 Lactobacillus HJL-24 Lactobacillus HJL-25 Lactobacillus HJL-30 Lactobacillus HJL-32 Lactobacillus HJL-33 Lactobacillus HJL-34 Lactobacillus HJL-37 Lactobacillus...
- 5
- 562
- 2
Báo cáo khoa học: "Regional Eradication of Mycoplasma hyopneumoniae From Pig Herds and Documentation of Freedom of the Disease" doc
... 20 - B A < /b> A B A < /b> A A < /b> A A < /b> A A < /b> A A < /b> A A < /b> A A < /b> A A < /b> A A < /b> A Ac Cc Cc Cc Cc No of colostral whey Time of or serum samples eradication (month/year) positiveb total 18 11 25 11 13 18 13 6 14 8 18 2 8a < /b> 1 5a < /b> 24 ... collected by the local practitioners or by the second or third author The samples were sent to the laboratory on the same day as collected without separation of serum At the slaughterhouse, blood samples ... samples; The field trial had welldefined epidemiological and economical tar- Eradication of Mycoplasma hyopneumoniae gets, which were openly declared; Respect was paid to the good collaboration between...
- 10
- 255
- 0
Báo cáo hóa học: "Retention of progenitor cell phenotype in otospheres from guinea pig and mouse cochlea" ppt
... MO), and incubated for 15 minutes at 37 C Further enzymatic dissociation of organ of Corti was achieved by adding CaCl2 to mM and 600 U/mL collagenase type II (Invitrogen, Carlsbad CA) and incubating ... in a < /b> carbon dioxide chamber Tissue isolation and dissociation After bathing the animals in absolute ethanol, they were decapitated and had the temporal bones removed and Page of 10 maintained ... microtube, and the supernatant was discarded by aspiration After washing the sample twice with HBSS, cells were mechanically dissociated by passing through firepolished Pasteur pipettes with decreasing...
- 10
- 476
- 1
Báo cáo y học: "tudies on Xenopus laevis intestine reveal biological pathways underlying vertebrate gut adaptation from embryo to adult" docx
... USA) All animals were maintained and used in accordance with the guidelines established by NICHD Animal Use and Care Committee RNA extraction and microarray analyses RNA was isolated and subjected ... locus 18.55 BC054284 HSD1 1B1 Hydroxysteroid (11-beta) dehydrogenase 15.61 BC054987 NAALADL1 N-acetylated alpha-linked acidic dipeptidase-like 15.98 10 BC056841 AMY 2A < /b> Amylase 12.21 11 BC056856 CPA1 ... métamorphose des amphibiens CR Acad Sci 1977, 284:2261-2263 13 Sharov AA, Dudekula DB, Ko MS: A < /b> web-based tool for principal component and significance analysis of microarray data Bioinformatics 2005,...
- 20
- 242
- 0
Báo cáo y học: "Lessons learned from the initial sequencing of the pig genome: comparative analysis of an 8 Mb region of pig chromosome 17" ppsx
... Given the importance of pig as an agricultural species and a < /b> biomedical model, greater advances in many aspects of porcine and mammalian science might be made if further funding was made available ... particularly for understanding complex traits such as obesity and cardiovascular disease Alongside other recently sequenced mammalian species of biological significance, such as cow (sequenced to ... sequence was searched against vertebrate cDNAs and expressed sequence tags (ESTs) using WUBLASTN and matches were cleaned up using EST2_GENOME A < /b> protein database combining non-redundant data from...
- 12
- 340
- 0
Báo cáo sinh học: "Biodiversity of pig breeds from China and Europe estimated from pooled DNA samples: differences in microsatellite variation between two areas of domestication" pdf
... Hunan China, Hunan China, Jiangsu China, Jiangsu China, Jiangsu China, Jiangsu China, Jiangxi China, Jiangxi China, Jiangxi Type CC CC SC CC SC SC SC CC SC SC SWC SWC SWC SWC SC SC SC SC NC SWC ... China has been categorized, based on exterior and production traits and historical data, into six geographic areas [49] Most local breeds come from the Central Chinese (CC), South Chinese (SC), ... al Table I Continued Breed Licha Black Hanjiang Black Mashen Neijiang Yanan Tibetan/Zang Jiaxing Black Jinhua Shangyu Spotted Meishan Meishan Presticke Créole Landrace Piétrain Large White Landrace...
- 26
- 306
- 0
Anaerobic digestion of pig manure and glycerol from biodiesel production
... International Union of Pure and Applied Chemistry [17] Performance of anaerobic digestion was evaluated by biogas yield The biogas production was collected by liquid displacement method and biogas composition ... state conditions The HRT was reduced stepwise from 10 to and 2.5 days corresponding to OLRs as shown in Tables and The biogas produced was sampled from reactor headspace for quality analysis and collected ... C) with initial pH of 7.2 for week Each digester was shake-mixed manually once a < /b> day [15] The biogas produced was sampled from digester headspace for quality analysis and collected in gas collection...
- 8
- 296
- 0
Structure and function of methyltransferases from antibiotic resistance bacteroides of human intestine and a study on nm ng with cam
... 5’CTTTCATATGCATCATCATCATCATCATAGTAACAATAATACAT’3 Reverse: 5’ CTTTCTCGAGTCATCTTTTTTGTCCTATATAGAATACGTA’3 BVU_3255: Forward: 5’ CTTTCATATGCATCATCATCATCATCATAATAATGAC ’3 Reverse: 5’ CTTTCTCGAGTCACCTTCTCAGTGAGAATCC’3 ... substances, and biotransformation of bile acids and other steroids Hence Bacteroides are also classified as saccharolytic meaning that they obtain carbon and energy by hydrolysis of carbohydrate ... before pulling the polysaccharides into the periplasm for monosaccharide degradation Their DNA-base composition of Bacteroides is about 40-48% G -C Ability of Bacteroides bacteria to process the...
- 155
- 408
- 0
Formulas from combustion Analysis
... 1.467g CO2 0.6003 g H2O i gi i: Kh i l ng c a < /b> cacbon dioxit n c có th d ng tìm s mol c a < /b> cabon hydro Kh i l ng c a < /b> oxy c th x c nh t kh i l ng c a < /b> ch t g c B i theo nh lu t b o toàn kh i l ng ta c : ... t cháy 0.360 g ch t thu c 0.406 g CO2 0.250 g H2O i gi i: Tr c h t x c nh kh i l ng s mol c a < /b> cacbon, hydro t CO2 H2O Trang Tìm c ng th c phân t formulas from combustion analysis S mol cacbon ... nghi m cho s tìm c b ng c ch thu c công th c phân t Ví d Kh i l ng mol c a < /b> ch t Ví d 120 g/mol Tìm c ng th c phân t c a < /b> i gi i: ví d ta c : c ng th c kinh nghi m c a < /b> h p ch t CH2O kh i l a < /b> là:...
- 4
- 585
- 0
How to setup a Linux system that can boot directly from a software RAID
... Id 83 83 System Linux Linux [root@fedora4 giotex]# mdadm manage /dev/md0 add /dev/hdc1 mdadm: hot added /dev/hdc1 [root@fedora4 giotex]# mdadm manage /dev/md1 add /dev/hdc2 mdadm: hot added ... RaidDevice State active sync 0 active sync 1 22 1 active sync [root@fedora4 ~]# mdadm examine /dev/hdc1 /dev/hdc1: /dev/hda1 /dev/hda1 /dev/hdc1 Magic Version UUID Creation Time Raid Level Raid ... sync active sync /dev/hdc1 /dev/hda1 /dev/hdc1 To be able to boot from the second disk if the first fails, GRUB has to be installed on both disks This cab be done with: 10 [root@fedora4 ~]# grub...
- 14
- 567
- 1
Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf
... England and Ireland Sometimes the two are called sister kingdoms; often they are imaged as husband and wife, happily or unhappily joined; occasionally, too, as mother and child, as father and daughter, ... situation, then the postcolonial mode of analysis that informs both the Field Day Anthology and the scholarly work of the major critics associated with Field Day has transformed the practices and ... as radically different, or as nearly the same Constituted through figures of gender, class, and race, a < /b> particular colonial relation emerges as both historically speci c and contextually variable,...
- 240
- 1,195
- 5
Cambridge.University.Press.Bioarchaeology.Interpreting.Behavior.from.the.Human.Skeleton.Feb.1999.pdf
... Africa, the South-east Asian cluster and North America are distinct because of the periods of isolation caused by deserts, ice and sea barriers South America and Australia, had they been included ... landscapes Adaptation to intermediate and then open habitats and landscapes enabled range expansions 38 Neanderthals and Modern Humans in humans Because habitats and landscapes frequently changed ... (Anderson, 1984) and is represented today by the widespread middle Pleistocene wild boar S scrofa, and South-east Asian bearded pig S barbatus (and a < /b> number of South-east Asian island forms) and...
- 268
- 913
- 3
Cambridge.University.Press.Debating.Design.From.Darwin.to.DNA.Nov.2007.pdf
... American Association for the Advancement of Science and the American Society for Cell Biology, and he has been chairman and council member of the ASCB, editor of The Journal of Cell Science, and ... What theologians once termed an established order of creation is rather a < /b> natural order that dynamically creates, an order for creating The order and newer accounts both concur that living creatures ... has been president and chairman of the board of the American Association for the Advancement of Science (1993–96) and was a < /b> member of the President’s Committee of Advisors on Science and Technology...
- 423
- 598
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf
... murdered And the marketing Draculas are draining the very lifeblood away from brands Brands are being bargained, belittled, bartered and battered Instead of being brand-asset managers, we are committing ... other costs A < /b> welcome trend would be that advertisers pay advertising agencies on a < /b> pay-for-performance basis This would be reasonable because the agencies claim that their creative ad campaigns ... skyscraper elevators and bathrooms Media selection is becoming a < /b> major challenge A < /b> company works with the media department of the ad agency to define how much reach, frequency, and impact the ad campaign...
- 226
- 1,421
- 7
Removal of congo red from wastewater by adsorption onto waste red mud
... employed (7) and the of wastewater dye as a < /b> typical case (13) EXPERIMENTAL Materials Waste Aluminium the at Factory adsorbent water for red Tamil powder was from was obtained M/S India) Nadu, was washed ... several problems photodegradation treated by the Activated available adsorbent is carbon and has of aerobic an attractive adsorbent stable to (2); hence, they cannot be methods of dyes provides ... of dyes and heavy metals include residual use slurry agricultural (4), banana solid pith wastes such (5), orange as biogas peel (6), 403 bagasse as and paddy straw Fe(III)/Cr(III) Namasivayam...
- 17
- 897
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25