a an understanding of the nature of the act and the circumstances in which it has occurred and
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... multidimensional, and can be described or seen in various ways, including both wet (experimental) and dry (computational and theoretical), reductionist and synthetic, qualitative and quantitative, and a ... including creating it, storing it, editing it, comparing it with other stored models, nding it again in a principled way, visualizing it, sharing it, running it, analysing the results of the run, ... 2C, D and E highlight the basic and iterative relations between computational models and reality on one hand and between changes in the model that are invoked and its subsequent dynamic behaviour,...
- 22
- 706
- 0
Báo cáo hóa học: " An exploration of job stress and health in the Norwegian police service: a cross sectional study" docx
... and design, acquisition, analysis and interpretation of data and drafting of the manuscript EH was involved in design, interpretation of data, drafting of the manuscript and supervision ØE was ... was involved in conception and design, interpretation of data, drafting of the manuscript and supervision BL was involved in analysis and interpretation of data AMB is the guarantor for this paper ... Inventory b HADS – Hospital Anxiety and Depression Scale down in adaptation that results from the long-term imbalance of demands and resources [33] and may result in cynicism As the samples in...
- 9
- 443
- 0
Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot
... There was a particularly troubling bone pain involving his forearms, wrists and hands bilaterally The arm pain was unpredictable, episodic and intense with aching and burning qualities There were ... devise the drug regimen and conducted the initial literature search I also wish to acknowledge the assistance of Dr Mike Harlos and the many participants on PaedPalCare for their clinical advice ... Vigano A, Romano F, Neumann C, Hanson J, Quan HK, Walker P: Safety of subcutaneous clodronate and efficacy in hypercalcemia of malignancy: a novel route of administration J Pain Symptom Manage 2003,...
- 4
- 423
- 1
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx
... International Classification of Functioning, Disability and Health and the position of the variables included in the study by Brionez and colleagues [1] AS, ankylosing spondylitis; BASFI, Bath Ankylosing ... psychological variables and biomedical factors would help improve our understanding of, and insight into, health outcomes Identification of a core set of psychological variables from the increasingly large ... seen as the major mechanism of a positive reference shift, which refers to the idea that patients not rate their health in reference to an absolute standard but in reference to a relative standard...
- 3
- 256
- 0
Báo cáo y học: "Phagosome proteomes open the way to a better understanding of phagosome function" ppsx
... Staphylococcus aureus [1] The fact that 28% of the RNAs tested affected the process of uptake, either increasing or decreasing bacterial uptake, strongly validates the initial screening with LBPs and the interactome ... classes of luminal proteins include hydrolases and other bacteriocidal proteins In the phagosome membrane are found the various subunits of the proton transporter H+-ATPase, other transporters and ... causing the initiation of intracellular signaling pathways, most prominently those leading to the membranedependent assembly of actin filaments and the exocytosis of various membrane compartments These...
- 4
- 239
- 0
SEEKING AN UNDERSTANDING OF THE GROUNDWATER AQUIFER SYSTEMS IN THE NORTHERN SACRAMENTO VALLEY
... non-marine, formations exist in the northern Sacramento Valley They are the Alluvial deposits, the Tuscan Formation, units A and B, the Tuscan Formation, unit C, and the Tehama Formation These ... below the Tuscan Formation and the Tehama Formation, and above the Great Valley Sequence, Neroly Formation, and Ione Formation represents the approximate contact between fresh and saline groundwater, ... groundwater The Alluvium, the Modesto and Riverbank Formations, and the Basin deposits are identified as Qa, Qm, Qr, and Qb, respectively, in Figure The Alluvium is composed of gravel, sand and...
- 4
- 117
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... characteristic of the TGFb superfamily type I receptors are in bold and underlined, and the cysteine knot is boxed Also boxed are the transmembrane domain, the ATP binding site, the L45 loop and ... to interact with both BMPs and activins via its double extracellular ligand binding domains Such promiscuous behaviour has already been described for the Drosophila sax [42] and Caenohabditis ... screens in flies (mad Drosophila mutants) and worms (sma Caenorhabditis mutants) These move to the nucleus to associate with transcriptional coactivators and regulate the transcription of target...
- 17
- 508
- 0
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx
... be a critical source for maintaining a steady Cys availability as it is continuously exported out of cells into plasma and converted to circulating cysteine by the action of c-GT and dipeptidase ... converted into CysGly and then into Cys by the combined action of the membrane enzymes c-glutamyl transpeptidase (cGT) and dipeptidases (DP) The activity of cGT is inhibited by acivicin Alternatively, ... previously [43] Maintenance of an adequate plasma thiol–disulfide balance appears to be fundamental It has been demonstrated that even a minimal shift in the redox state of either the Cys ⁄ CySS...
- 13
- 510
- 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation SDS/PAGE and western ... corresponding band was present in the same peak elution fraction in the TatAy immunoblot, indicating the presence of a TatAyCy complex The vast majority of the TatAy protein did not bind the column and...
- 12
- 445
- 0
Families Under Stress - An Assessment of Data, Theory, and Research on Marriage and Divorce in the Military pptx
... of marital outcomes, variously referred to as marital stability, marital adjustment, marital quality, marital satisfaction, marital dissolution, marital conflict, and many more (Karney and Bradbury, ... be a history of the social and institutional changes that have a ected military couples over the same period By mapping changes in rates of marriage and marital dissolution within the military ... Afghanistan and Iraq, the demands on the military have been higher than they have been at any time since the Vietnam War In particular, deployments, especially for the Army and the Marine Corps, have...
- 246
- 386
- 0
THE EXPOSURE OF YOUTH TO UNWANTED SEXUAL MATERIAL ON THE INTERNET: A National Survey of Risk, Impact, and Prevention pdf
... other races including American Indian, Alaska Native, Asian, and Hispanic White Twenty percent of youth lived in a single-parent household Nearly half (46%) lived in households with an annual ... / MARCH 2003 ventive measures (such as the adoption of filtering and blocking software) and incidents of exposure Longitudinal and qualitative research, along with the use of standardized measures, ... at the level of more than a little or all the time during the days right after the incident happened In another series of bivariate analyses, few of the characteristics of the youth, their patterns...
- 29
- 529
- 0
Due process and the development of financial accounting standards An exploration of comment letters and their influence on financial accounting standards
... selects a financial accounting standard where comments letters were used and compares the change in this financial accounting standard to an additional randomly selected financial accounting standard ... standard setting Cross Case Analysis Random Case Random Case Final financial accounting standard, including all related source documents, after FASB issued standard Final financial accounting standard, ... qualitative report Note Numeric indicators reference Linking of Data Points UA is Unit of Analysis Code comments and relate to FAS changes Compare change in standard Financial accounting standard,...
- 168
- 500
- 0
báo cáo khoa học: "Speciation burst hypothesis : an explanation for the variation in rates of phenotypic evolution" pps
... forms of animals and plants first appeared in the Arctic and migrated later to temperate climes They report that data from the « Eureka Sound Formation in the Canadian high Arctic reveals profound ... between the time of appearance of fossil land plants and vertebrates in the Arctic and mid-northern latitudes Latest Cretaceous plant fossils in the Arctic predate mid-latitude occurrences by as much ... characters as being a consequence of the exposure to and sensitivity of the organism to ultraviolet light and/ or cosmic rays The mitigating factors affecting exposure such as latitude, aquatic...
- 7
- 363
- 0
Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt
... plexus, and the median, radial, and ulnar nerves were each transected cm distal to where they branched off of the brachial plexus and loosely sutured to the anterolateral aspect of the normally innervated ... analysis of the histologic specimens; and TK and GD participated in the design and coordination of the model All authors read and approved the final manuscript Competing interests The authors declare ... significant differences in the median, radial, and ulnar neuromas in terms of myelinated axon counts at a distance of 15 mm proximally However, it is important to note that whereas Scadding and Thomas...
- 10
- 433
- 0
báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf
... indicate testing fasting blood glucose within two years and LDL within one year, measuring BP within six months, and having active prescriptions for aspirin, a statin, and an angiotensin-modifying ... measuring BP and glycosylated haemoglobin within six months, and having active prescriptions for a statin and an angiotensin-modifying agent For patients with IHD, a maximum score of would indicate ... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them...
- 10
- 597
- 0
báo cáo khoa học: "The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis" pptx
... to amplify full-length cDNAs: ACR9, 5’-TGTTGTT GATTCATTGGCTC-3’ and 5’-AGTAGTAGATGAATATATTG-3’; ACR10, 5’-ATAGGAGGAACAACACAAAC-3’ and 5’-TTACTATGAAACCCACACAG-3’; ACR11, 5’-AAAAGGATCCATGGCTATGGCCTCT ... proteins, and the Figure Amino acid sequence alignments of ACR proteins and ACT domains (A) Sequence alignment of Arabidopsis ACR11 and ACR12 proteins ACT domains are indicated with solid lines above ... domains It has been shown that the C-terminal ACT domains of GlnD may regulate its activity through the binding of glutamine [21] The ACT domain, named after bacterial aspartate kinase, chorismate...
- 10
- 420
- 0
báo cáo khoa học: " Intervening in global markets to improve access to HIV/AIDS treatment: an analysis of international policies and the dynamics of global antiretroviral medicines markets" potx
... data analysis and writing of the manuscript MK and TB contributed to the writing of the manuscript and edited it for important content JH conducted data analysis and contributed to the writing ... serve as consultants for UNITAID Authors' contributions BW designed and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED, LS and ... person-years of volume in 2008 Trends in FDC market share across purchasers and manufacturers Analysis of market share by both purchasers and the manufacturers that supply them reflects the dominant...
- 19
- 398
- 0
báo cáo khoa học: " A qualitative assessment of stakeholder perceptions and socio-cultural influences on the acceptability of harm reduction programs in Tijuana, Mexico" ppsx
... drafting of the manuscript RL and AM aided in the collection and analysis of interview data CAL participated in the design of the study and all authors read and approved the final manuscript SAS ... conceived of the study, participated in its design and coordination, and helped with the drafting and editing of the manuscript PC contributed to the conception, theory, and design of the study, and aided ... Russia, Malaysia, Vietnam, and China [36-38,24] Bluthenthal et al [39] found a 46% increase in the total number of California's NEPs after the passage of an assembly bill eliminating criminal prosecution...
- 9
- 310
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008