a absolute viscosity of a gas as a function of temperature near ambient pressure

Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

... provocation (as the ratio lowest/baseline FEV1) was compared between treatments in an additive analysis of variance model with subject, period and treatment as fixed factors and the test-day baseline ... article as: Aalbers et al., Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, ... AG, Rasidakis A: Comparison of formoterol and terbutaline for as- needed treatment of asthma: a randomised trial Lancet 2001, 357:257-261 Pauwels RA, Sears MR, Campbell M, Villasante C, Huang S,...

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Danh mục: Báo cáo khoa học

... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... Each value was analysed using Mann-Whitney (between two groups) or anlaysis of variance (ANOVA; among three groups) tests Statistical significance was considered at P < 0.05 The number of bacteria ... Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References Doebbeling BN, Stanely GL, Sheetz CT, et al:...

Báo cáo y học: "Better mental health in children of Vietnamese refugees compared with their Norwegian peers - a matter of cultural difference" ppt

Danh mục: Báo cáo khoa học

... stigmatized [28], immigrant adolescents may feel less comfortable reporting behaviours that might be perceived as deviant Such social desirability may be seen as a bias, as well as an adaptation ... study A major advantage as well as a challenge of the study was the comparison of the Norwegian-Vietnamese and the Norwegian community samples Some basic information available in both samples ... PD: Assessing Asian American family acculturation in clinical settings: Guidelines and recommendations for mental health professionals In Handbook of mental health and acculturation in Asian American...

Báo cáo lâm nghiệp: "Litterfall, nutrient return, and leaf-litter decomposition in four plantations compared with a natural forest in subtropical China" ppt

Danh mục: Báo cáo khoa học

... of leaf litter Compared with those of conifers, leaf-litters of broadleafs had less recalcitrant materials and faster decay rate for dry matter, as well as faster actual release of N O xylocarpa ... Table I NF represents the evergreen, broadleaved C kawakamii forest in mid-subtropical China with high purity (85% of total stand basal area for C kawakamii), old age (∼ 150 year), and large area ... xylocarpa (OX), and Castanopsis kawakamii (CK), and an adjacent natural forest of Castanopsis kawakamii (NF); (ii) quantify nutrient return through litterfall Monthly rainfall; Monthly mean temperature...

Báo cáo hóa học: " Research Article Absolute Stability of Discrete-Time Systems with Delay" pdf

Danh mục: Báo cáo khoa học

... For an n × n-matrix A, denote n N2 A − g A λj A 1/2 , 4.9 j where N A is the Frobenius Hilbert-Schmidt norm of a matrix A, N A Trace ∗ AA , and λ1 A , λ2 A , , λn A are the eigenvalues of A, ... Ax k Bx k −m f k with commutative matrices,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 63–76, 2006 S Elayi and S Zhang, “Stability and periodicity of diﬀerence equations ... stability problem was not investigated in this paper Kipnis and Komissarova investigated the stability of the system xn Axn−1 Bxn−k , 4.3 where A, B are m×m-matrices, xn ∈ Rm By means of a characteristic...

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx

Danh mục: Báo cáo khoa học

... equilibration between additions at 25 °C The absorbance between 350 and 750 nm was measured on a Beckman DU7400 single-beam spectrophotometer Assay of DmDHO by measuring bilirubin formation The catalytic ... addition of NADPH to both the sample and reference cuvette As depicted in Fig 9, the myoglobin Soret band shifted from 393 to 425 nm with the appearance of a/ b bands at 568 and 538 nm and A4 25 increased, ... metabolism [30] In the present study, we found a putative HO gene in D melanogaster by homology searching in FlyBase, a database of genetic and molecular data for the fruit ﬂy The D melanogaster...

Married to the Military - The Employment and Earnings of Military Wives Compared with Those of Civilian Wives doc

Danh mục: Cao đẳng - Đại học

...

Báo cáo khoa học: "morphological characteristics, root growth potential and flushing response of rooted cuttings compared with transplants of Sitka spruce" pps

Danh mục: Báo cáo khoa học

... [41], and in Norway spruce [19] The light branching habit is probably an effect of phase change or ageing Branching behaviour is known to be influenced by plant age and/ or maturation [12, 15] A decline ... each variable Height increment as a percentage of initial height was also used in the analyses because height at planting differed between stock types plants A factorial ANOVA following a randomised ... fibrous root dry weight ratio also showed the same trend 3.2 Root growth potential and burst in greenhouse tent and variation was lower each year, whereas values often changed greatly and variation...

báo cáo khoa học: " Osseointegration of zirconia implants compared with titanium: an in vivo study" ppsx

Danh mục: Báo cáo khoa học

... Journal of Applied Biomaterials & Biomechanics 2003, 1:19-32 Akagawa Y, Hosokawa R, Sato Y, Kamayama K: Comparison between freestanding and tooth-connected partially stabilized zirconia implants after ... followed by months of loaded healing (68% for sandblasted zirconia implants and 73% for sandblasted and acid-etched titanium implants) However, the surface topography was not measured or described ... zirconia implants with surface modification after weeks of healing in the tibia of rabbits Scarano et al [10] observed 68% BIC of the untreated zirconia implants after weeks in the tibia of rabbits...

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Danh mục: Môi trường

... performance and design of air- breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air- breathing ... porous gas diffusion layer and catalyst layer is described by two physical mechanisms: viscous drag and capillary pressure forces, and is described by advection within the gas channels Water transport ... density increase with decreasing height of the fuel cell, decreasing ambient temperature and increasing ambient relative humidity Hwang et al [4] developed a single-phase 3D model of coupled fluid...

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Danh mục: Báo cáo khoa học

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp9 0b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains ... tryptophan Automated measurement of the b- galactosidase activity due to basal and stress-induced expression of the interaction-responsive, GAL7 promoterregulated LacZ gene of PJ69-4 was as previously...

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Danh mục: Báo cáo khoa học

... (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation ... performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity were analyzed The intra-assay and interassay variabilities (coefficient of variation ... high-performance liquid chromatography The molecular mass was found to be 1708.1 Da (average; Precision and reproducibility Measurements of imprecision (interassay and intra-assay variability) were taken...

Báo cáo y học: "False positive diagnosis of malignancy in a case of cryptogenic organising pneumonia presenting as a pulmonary mass with mediastinal nodes detected on fluorodeoxyglucose-positron emission tomography: a case report" ppsx

Danh mục: Báo cáo khoa học

... scan, a right anterior mediastinotomy and bronchoscopy Bronchoscopy findings were normal, and cytological analysis of a transcarinal aspiration showed a small number of lymphocytes and macrophages ... fissure between the upper and middle lobes Enlargement of the paratracheal, para-oesophageal and hilar nodes was noted Biopsies were taken from the right upper lobe, paratracheal nodes, para-oesophageal ... evidence of fungal colonisation was found in the resected lung Although COP has been associated with a variety of infections including fungal infections, we are not aware of any association with ABPA...

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Danh mục: Cao đẳng - Đại học

... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 CBP ... in Singapore and other East-Asian populations with relatively high allelic frequencies This variant was associated with perturbations in plasma lipid levels and modulated the association between ... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated...

Biomass gasification in a downdraft gasifier with a twostage air supply: Effect of operating conditions on gas quality

Danh mục: Báo cáo khoa học

... eucalyptus biomass gasification in a downdraft gasifier using three different configurations: single stage (SS), two-stage air supply (AA) and two-stage air and air -gas (AG) The tar content in the gas ... combustion reactions, leading to a decrease of the LHV of the gases Jaojaruek et al [4] in a downdraft gasifier with two-stage air supply also using eucalyptus biomass as fuel, obtained as a result an ... this case there was an interest to confirm that at a two-stage gasification, the main gas quality indexes, such as tar and particle content, are linked to the gasifier operational parameters (Air...

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Danh mục: Y học thưởng thức

... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial ... Chicago, USA) Continuous variables were described as mean ± standard deviation (SD), and categorical variables were reported as percentages or proportions Comparison of continuous variables was performed ... 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation...

Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&

Danh mục: Y học thưởng thức

... 001 04 307 Abbreviations: CABG, Coronary artery bypass graft; MACE, Major adverse cardiac event (ie, death, myocardial infarction, and target vessel revascularization a Indicates patients who ... and target vessel revascularization (TVR) MI was defined as the elevation of creatine kinase (CK) > times above the upper limit of normal with any associated elevation in the CK myocardial band ... was associated with poor overall clinical outcomes compared with outcomes associated with SES treatment Also, in the multivariate analysis, after adjusting for clinical variables, we found that...

600 sentences of certificate A and B

Danh mục: Cao đẳng - Đại học

... father a than b as c but d and > a 48 I am teacher a the b a c an d no article > b 49 My uncle is good engineer a the b a c an d no article > b 50 That is eraser a the b a c an d no article ... being started by hand But now they are started by electricity a used b being c But now d are > b 33 This house is often broken off and a lot of things are taken away a is b broken c off d away ... my garden," the woman said a because b for c by d as soon as > a 156 The woman has hurt her back for too long a to bend b by bending c for bending d owing to you bend > b 157 A lot of passengers...

A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

Danh mục: Thạc sĩ - Cao học

... together with the input variables, control variables and state variables Considering a system element with an input variable x(t), a state variable s(t), a control variable c(t) and an output variable ... basin management and/ or ecosystem-based river basin management (Nakamura, 2003) Embedded in these approaches are the concepts of participatory management and adaptive management (Miser and Quade, ... conducted by means of the Morris analysis, as in this chapter Examples of the decision variables in RaMCo are the number of fish blasts, the total capacity of urban wastewater treatment plants, and...

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Danh mục: Khoa học xã hội

... 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class of words ... case Such as: Have you got any bread? Do you want white or brown? (Michael Swan, 1996, p14) White and brown are adjectives as heads of a noun phrase They mean that white bread and brown bread ... sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: How good of you! An exclamation is a sentence spoken with emphasis and feeling Attention...

44
1,746
7

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25

a absolute viscosity of a gas as a function of temperature near ambient pressure and b relative viscosity of a gas compared with air