... techniques Basal and follow-up values were measured at the beginning and at the end of each treatment phase, respectively Multivariate analysis of variance (MANOVA) was used for comparison of the ... concentrations in patients with coronary artery disease (CAD) and hyperhomocysteinemia MATERIALS AND METHODS Twenty-two male outpatients with a history of CAD (angina or myocardial infarction at least ... treatment (diet or supplement), and follow-up (basal or follow-up measures) and each dependent variable (tHcy, folic acid and cobalamin and lipid metabolism parameters) was analyzed separately...
... midstream area of Uji River and around the junction of Uji River and Niyodo River There are many pulp factories around the downstream area of Saina River, and the wastewater from the factories ... Takaaki Doi and Mr Daisuke Hagiwara for their support for this work We are also grateful to the financial support by Charitable trust wastewater management research promotion fund REFERENCES Ana ... from various land cover types J Water Pollut Control Fed., 252-264 Standard Methods for Examination of Water and Wastewater (1998) 20th edition, American Public Health Association / American Water...
... the yearly PAHs loadings were estimated using the meteorological data of 2006 The meteorological data was obtained from the Japan Meteorological Agency, and the data at Higashihiroshima was used ... loading was 66 µg m-2 year-1 For comparing the river discharge loading, the yearly loadings arisen from road traffic and atmospheric deposition were estimated in this river basin area The road traffic ... Kurose River, and loading on rainy days and that on non-rainy days was clarified to be in the same order The yearly PAHs loadings were compared to road traffic and atmospheric deposition in the river...
... remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin ... pregnancy There was a significant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... renal transplants, but specialists were becoming increasingly reluctant to advise women with transplants against trying for a baby, as medical care for ‘high risk’ pregnancies was improving dramatically...
... n h a h c c a tinh d u Alpinia breviligulata Gagnep 3.2.6.1 K t qu xác ñ nh thành ph n h a h c c a tinh d u Alpinia breviligulata Gagnep Hình 3.1 S c ký ñ GC c a TD Alpinia breviligulata Gagnep ... ph n h a h c c a tinh d u thân r Alpinia breviligulata Gagnep Hình 3.11 S c ký ñ GC c a TD thân r Alpinia breviligulata Gagnep B ng 3.10 TPHH c a TD thân r RMN (Alpinia breviligulata Gagnep.) ... tinh d u thân Alpinia breviligulata Gagnep Hình 3.8 S c ký ñ GC c a TD thân Alpinia breviligulata Gagnep 14 B ng 3.9 TPHH c a TD thân RMN (Alpinia breviligulata Gagnep.) Đà N ng T gian lưu 3,78...
... a Cohen-Macaulay S -module (ii) LT is a maximal Cohen-Macaulay ST -module if L is a maximal Cohen-Macaulay S -module Proof We need only show that (LT )piT is a (maximal) Cohen-Macaulay (ST )piT ... Lα is also a Cohen-Macaulay Sα -module for almost all α Since Lα = (LT )piT , it follows that LT is a Cohen-Macaulay ST -module for almost all α (ii) Assume that L is a maximal Cohen-Macaulay S ... separable prime ideal if it’s ground-form is a separable polynomial We have the following lemma: Lemma 2.1.[1, Satz 14] A specialization of a prime separable ideal is an intersection of a finite prime...
... Justice and the Minister of the Interior were contacted in particular FIDH-OMCT / PAGE Defending Economic and Social Rights in Cambodia A High-Risk Activity A Cambodia - A Snapshot Cambodia has made ... party has effectively collapsed The 2006 law on adultery promulgated by the National Assembly, which made adultery a criminal offence, is also seen as politically motivated Prince Ranariddh was ... concessions are defined as a mechanism to grant state private land for agricultural and industrial-agricultural exploitation The purposes for which they may be granted include investment in agriculture,...
... 5¢-CCTCCGAAACAGGACTGTCAGGGGG TACCAGGTAATGCATCACAACGTTTTCACGGTTGA TTCTCTGTTTCAGCGTACCC-3¢ The two primer binding regions are located in the 5¢-terminus and 3¢-terminus A mL PCR reaction with each primer ... polymerase, rNTPs and transcription buffer were obtained from Fermentas (St Leon-Rot, Germany) RNA preparation The sequence of primer P1 (promoter primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, ... 3-methyladenine and 2,6diaminopurine, which share the amidine group of adenine, restore the activity to abasic ribozyme variants lacking A3 8 Detailed analysis of the pH dependence of hairpin ribozymes variants...
... AAUAAA [20] This canonical nuclear polyadenylation signal is believed to have a role in the 3¢ end formation of nuclear RNA polymerase II transcripts and also yeast mt mRNAs [21,22] Similar A/ T-rich ... in a unidirectional manner Materials and methods Preparation of mt extract capable of transcription initiation Mt extract from HeLa cells rich in RNA polymerase activity was prepared as described ... 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination site will be referred to as promoter distal transcription...
... spacemen lived at an accelerated pace A nine-year trip to Alpha Centauri and back seemed to take only six weeks to men on a spaceship When they returned, their friends and relatives had aged enormously ... the mentatype Robert Silverberg Starman's Quest The Lexman Spacedrive gave man the stars—but at a fantastic price Interstellar exploration, colonization, and trade became things of reality The ... Oppenheim An Amiable Charlatan "The thing happened so suddenly that I really had very little time to make up my mind what course to adopt under somewhat singular circumstances I was seated at my favorite...
... position was unfortunate owing to a weak salient We had already heard guns, but on my way back I heard a distant crash, and looked round to find that a shell had burst half a mile away on a slag-heap, ... uncomfortably on straw in a back yard, and rose again just before dawn We breakfasted hastily at a café, and were off just as the sun had risen Our day's march was to Dour, in Belgium, and for us a bad ... situation I proposed breakfast King and I had half a loaf of Saacy bread and half a pot of jam I always carried about with me The rest went to the men Our breakfast was nearly spoilt by the Manchesters,...
... buffer, appropriate CGGTATCGATAAGCTTGATTGACTTGACCGTCA amounts of GA were added to a final concentration of TCGGATTGACTTGACCGTCATCG-3¢, Amyb2: 5¢-CA 10 lM Isolated aleurone tissues were incubated ... treatment and returned to its basal value within 14 h In contrast, Amy2 mRNA reached a maximum at 14 h after the GA treatment (Fig 6B) These data suggest that RAMY could act as a regulatory or transcription ... Fig RAMY transcript levels in a rice plant subjected to GA treatment (A) GA induced RAMY mRNA accumulation in leaves and roots L, leaves; L + GA, leaves treated with GA; R, roots; R + GA, roots...
... Penn Treebank Computational Linguistics, 19(2):313–330 Tahira Naseem and Regina Barzilay 2011 Using semantic cues to learn syntax In AAAI Tahira Naseem, Harr Chen, Regina Barzilay, and Mark Johnson ... Computational Linguistics, pages 128– 135, Newark, Delaware, USA, June Association for Computational Linguistics Elias Ponvert, Jason Baldridge, and Katrin Erk 2011 Simple unsupervised grammar induction ... parsing no supervisado In 2do Workshop Argentino en Procesamiento de Lenguaje Natural Mitchell P Marcus, Beatrice Santorini, and Mary A Marcinkiewicz 1993 Building a Large Annotated Corpus of English:...