a 2 example of a site master file content based upon pic s guidelines
Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot
... studies examining the use of NSAIDs and coxibs in the community Death from gastrointestinal and cardiovascular events with NSAIDs and coxibs Systematic reviews and meta-analyses of observational studies ... The search strategy avoided meta-analyses of randomised trials, because many of the data in those came from trials with higher than licensed doses of coxibs, and maximum daily doses of NSAIDs This ... investiga- Risk of serious skin reactions with coxibs [64] [64] tion in both randomised trials and a retrospective metaanalysis of them, and meta-analyses of substantial numbers of observation studies...
- 16
- 463
- 0
The Design and Implementation of a Log-Structured File System
... results of a benchmark that creates, reads, and deletes a large number of small files Sprite LFS is almost ten times as fast as SunOS for the create and delete phases of the benchmark Sprite LFS is ... data area is reserved for this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space ... has the disadvantage of increasing the amount of data lost during a crash For this paper we will assume that crashes are infrequent and that it is acceptable to lose a few seconds or minutes of...
- 15
- 1,434
- 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Sense ... Asp 125 Ala/Glu 127 Ala/ Tyr183Phe Sense strand 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢ Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ ... Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ Anti-sense strand...
- 9
- 616
- 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
... GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC ... GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG ... pNPGlNAc hydrolysis Discussion It is generally accepted that family 20 hydrolases such as chitobiase from Serratia marcescens and human b-hexosaminidases operate via a retaining mechanism [17] In such...
- 13
- 311
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... various D-amino acids as substrate Analytical SDS/PAGE was carried out as described by Laemmli [15] The expression of the mutant enzymes was also determined by Western blot analysis, using an ... mutants we were able to exclude any possibility that Y 223 can act as an active -site base The differences in properties between Y 223 F and Y 223 S mutants suggest that the side chain at position 22 3 ... Activity assay and gel electrophoresis DAAO activity was assayed with an oxygen electrode at pH 8.5 and 25 C with 28 mM D-alanine as substrate at air oxygen saturation ([O2] ẳ 0 .25 3 mM) [14] One DAAO...
- 10
- 496
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... majority of V families Isolation and characterization of specific scFvs against Cn2 toxin After four rounds of biopanning, the recognition capacity of scFvs was evaluated by means of phage-ELISA ... monomeric fraction was used The BIACORE analysis (Fig 3; Table 2) showed a KD value of 410 pm, the best affinity value for the evolved variants Table Neutralization assays Results of mice groups challenged ... ª 20 05 FEBS Strategy to isolate human neutralizing antibodies cycle allowed selection of variant 6F (Table 2) , with a change at CDR2 of the heavy chain This mutant showed association and dissociation...
- 11
- 679
- 0
everest f.a. the master handbook of acoustics
... Resonators 21 5 Perforated Panel Absorbers 21 8 Slat Absorbers 22 4 Placement of Materials 22 5 Reverberation Time of Helmholtz Resonators Taming room modes Increasing Reverberation Time 22 5 22 6 22 9 ... Mechanical Acoustical Inductance Mass Inertance Resistance Resistance Resistance Capacitance Compliance Capacitance FIGURE 1-17 The three basic elements of electrical systems and their analogs ... acoustical system Capacitance in an electrical circuit is analogous to compliance in a mechanical system and capacitance in an acoustical system Resistance is resistance in all three systems, whether...
- 641
- 303
- 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
... 19 20 21 22 23 24 25 26 27 28 29 30 tans: insights into early archaeal evolution and derived parasitism Proc Natl Acad Sci U S A 20 03, 100: 129 84-8 Epub 20 03 Oct 17 Perler FB, Olsen GJ, Adam E: ... alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains Figure Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains The Mimivirus ... Mimivirus (TATGGAGAC/ACGGACTCA for the amino acid sequence YGD/TDS) and archaeal sequences For instance, the sequences from M jannaschii and Pyrococcus horikoshii exhibit 7-missmaches (TATATTGAC/ACTGATGGA;...
- 7
- 435
- 0
báo cáo hóa học:" A new example of viral intein in Mimivirus" potx
... 19 20 21 22 23 24 25 26 27 28 29 30 tans: insights into early archaeal evolution and derived parasitism Proc Natl Acad Sci U S A 20 03, 100: 129 84-8 Epub 20 03 Oct 17 Perler FB, Olsen GJ, Adam E: ... alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains Figure Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains The Mimivirus ... Mimivirus (TATGGAGAC/ACGGACTCA for the amino acid sequence YGD/TDS) and archaeal sequences For instance, the sequences from M jannaschii and Pyrococcus horikoshii exhibit 7-missmaches (TATATTGAC/ACTGATGGA;...
- 7
- 321
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx
... safety of surgical care globally This initiative - Safe Surgery Saves Lives - identified minimum standards of surgical care that can be universally applied across countries and settings [1] A ... 20 11 20 American Academy of Orthopaedic Surgeons: Advisory Statement; WrongSite Surgery AAOS; 20 09 [http://www.aaos.org/about/papers/advistmt/ 1015.asp], Accessed on 4th April 20 11 21 North American ... 360(5):491-9 12 Panesar SS, Cleary K, Sheikh A: Reflections on the National Patient Safety Agency s database of medical errors J R Soc Med 20 09, 1 02( 7) :25 6-8 13 National Patient Safety Agency: National...
- 7
- 443
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf
... safety of surgical care globally This initiative - Safe Surgery Saves Lives - identified minimum standards of surgical care that can be universally applied across countries and settings [1] A ... 20 11 20 American Academy of Orthopaedic Surgeons: Advisory Statement; WrongSite Surgery AAOS; 20 09 [http://www.aaos.org/about/papers/advistmt/ 1015.asp], Accessed on 4th April 20 11 21 North American ... 360(5):491-9 12 Panesar SS, Cleary K, Sheikh A: Reflections on the National Patient Safety Agency s database of medical errors J R Soc Med 20 09, 1 02( 7) :25 6-8 13 National Patient Safety Agency: National...
- 7
- 507
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’ )2 fragments Panitumumab (Amgen) was ... a nanomolar basis The immunoreactivity of the 111 In-panitumumab F(ab’ )2 was assessed in a radioimmunoassay as detailed previously using purified hEGFR [29 ,34] Serial dilutions of 111In-CHX -A" -panitumumab ... Reduced Figure SDS-PAGE analysis of panitumumab F(ab’ )2 The panitumumab F(ab’ )2 was evaluated by SDS-PAGE before (a) and after (b) the final step of buffer exchange and concentration using a Centriprep...
- 15
- 452
- 0
Báo cáo toán học: "A 2-COLORING OF [1, N ] CAN HAVE (1/22)N 2 + O(N ) MONOCHROMATIC SCHUR TRIPLES, BUT NOT LESS" potx
... routine calculation [R] shows that for ≤ s < ∞ F (Zs ) = 1 2s + n2 + O(n), 16(1 2s + 11) which is strictly increasing in s An easy calculation shows F (Z∞ ) = F (Z∞ ) = (1/16)n2 + O(n) And The ... n +2( s+ 1) , which is a local 1 2s+ 11 minimum for n sufficiently large Case III gives a local minimum when k ≡ 0, (mod 6) Hence The Local Minima Are: s s Zs := 04ws (16ws−1 06ws−1 ) 16ws−3 (06ws−1 ... If w ≥ n /2 then the (only) solution is 0n If w < n /2, then let s be the (unique) integer ≤ s < ∞, that satisfies n/(1 2s + 14) ≤ w < n/(1 2s + 2) Case I: If n/(1 2s + 8) ≤ w < n/(1 2s + 2) then the...
- 4
- 248
- 0
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx
... analysis revealed no association between the PTPN 22 gene and RA in a Japanese population Rheumatology (Oxford) 20 06 in press Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki ... Genet 20 03, 34:395-4 02 Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, Yamanaka H, Tomatsu T, Kamatani N: Association between PADI4 and rheumatoid arthritis: a replication study Arthritis Rheum ... all been associated with RA in the Japanese population on single-point analysis, because the SNPs formed a haplotype associated with RA and because the most probable disease causal SNP (FCRL3-169*C/T...
- 5
- 406
- 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
... 0.39 0. 02 Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) ... coefficient* Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... Maeroff GI: Scholarship assessed: Evaluation of the professoriate San Francisco, Jossey-Bass; 1997 Lynton EA, Elman SE: New priorities for the university San Francisco, Jossey-Bass; 1987 Rosamund...
- 8
- 341
- 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
... 0.39 0. 02 Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) ... coefficient* Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... Maeroff GI: Scholarship assessed: Evaluation of the professoriate San Francisco, Jossey-Bass; 1997 Lynton EA, Elman SE: New priorities for the university San Francisco, Jossey-Bass; 1987 Rosamund...
- 8
- 315
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... derangement/disruption Adult spondylolysis Disc syndrome Lumbar disc disease Sprain Myofascitis Strain Facet syndrome Spinal OA Dislocation *Other potential causes of low back pain symptomology Osteoporosis* ... obesity, these may be confounding factors [28 ] Other variables such as less activity and/or muscular weakness leading to obesity are also possible considerations Obesity and low back pain-related ... large muscular athletes who are in good cardiovascular shape, the rationale behind these numbers is that, across large population groups, there is an increased prevalence of certain diseases...
- 6
- 402
- 0
Báo cáo y học: "A diagnosis-based clinical decision rule for spinal pain part 2: review of the literature" pps
... to assess IER In the first, examiners assessed 20 different muscles on each of 25 patients with various symptom presentations They used a general observer-agreement statistic called the "Sav", ... respectively They also used the Roland Morris Disability questionnaire to measure disability and the Distress Risk Assessment Method to measure distress, and found these factors altered the SE, SP and PPV ... et al [77], that it is not necessary to assume a particular pain generating tissue when using the McKenzie assessment as a means of making treatment decisions In their study, clinical decisions...
- 17
- 379
- 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... is easiest to create” As there are many types of visual aids in presentation such as objects, models, charts, photographs, graphs, drawings, diagrams, maps, overhead projectors, chalkboards or ... language skills in the Omani ELT system Journal of Language & learning, 4, Al-Issa, A (20 06b) Language problems facing Omani learners of English ORTESOL, 24 , pp.19 -26 Al-Issa, A (20 0 7a) English language ... chalkboard, posters, handouts, slide projectors, etc Students should learn the advantages and disadvantages of each one to make use of it Most of the students surveyed in this study usually use...
- 50
- 454
- 2
A site specific design of a fixed pitch fixed speed wind turbine blade with multiple airfoils as design variable
... (20 11) 15 -23 D .A Spera, Models of lift and drag coefficients of stalled and unstalled airfoils in wind turbines and wind tunnels National Aeronautics and Space Administration, NASA/CR -20 08 -21 5434 ... acquire flow analysis for angles of attack from -8 to 22 at a Re = 925 ,000 then its results are saved in a text file A MATLAB script reads the previously written text files and extracts information ... location of Roswell NM The data consists of hourly data wind speed obtained from the National Oceanic and Atmospheric Administration [25 ] station name Roswell Industrial Air Park, NM US with station...
- 12
- 347
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25