9a c mismatch at editing site
Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx
... 3¢-phosphoglycolate-containing substrate was approximately twofold reduced in APE1-immunodepleted but not mockimmunodepleted cell extracts (Fig 4C, D) To demonstrate that deficient XRCC1 cross-linking was exclusively ... amount of XRCC1 remains the same in mock or Pol b-depleted cell extracts (Fig 3D), cross-linking of XRCC1 in the latter was reduced by approximately twofold (Fig 3E,F), indicating that Pol b is ... addition of the recombinant human protein, it was efficiently cross-linked to the 3¢-phosphate-containing substrate in XRCC1-depleted extracts (data not shown), indicating that, as in the case of Pol...
- 11
- 299
- 0
Báo cáo y học: "Successful renal re-transplantation in the presence of pre-existing anti-DQ5 antibodies when there was zero mismatch at class I human leukocyte antigen A, B, & C: a case report" doc
... crossmatch" A DQ mismatch was acceptable in the context of a zero mismatch at HLA A, B and C Conclusion As progressively more sensitive techniques become available for the final crossmatch, more HLA ... were a zero mismatch at HLA Class I A, B and C; they had two allele mismatches at DR and DQ Note that the first and second transplants shared the Class II HLA DQ antigens Case presentation In 1991, ... deceased donor was allocated to our patient because he was thought to have a zero antigen mismatch by conventional serologic assay The T cell antihuman globulin (AHG) crossmatch and flow T cell...
- 4
- 418
- 0
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"
... Med Sci 2009, reconstructive techniques for management of extensive loss of femoral and/or acetabular bone Mechanical complications and reconstruction strategies The exact rate of mechanical complications ... arthroplasty A spacer fracture can be either symptomatic or asymptomatic depending on the fracture localisation Symptomatic fractures (Figure 5) are usually the consequence of a spacer neck fracture and ... in some cases with a combined muscular insufficiency and large acetabular defects a spacer dislocation might still occur These cases should be also considered as candidates for a resection arthroplasty...
- 6
- 455
- 0
Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx
... indicated, and after an additional incubation of 15 at 37 C affinity cleavage was induced by the addition of 0.5 mM FeCl3 and 30 mM ascorbate and completed by an additional incubation of 30 at ... preincubation in the absence or presence of 36 lM GA, Hsp90 was affinity-cleaved in the presence of ATP, and/or different nicotinamide adenine dinucleotides at final concentrations of mM, as indicated ... (ICGEB, CRP/HUN 99-02) References } ´ Csermely, P., Schnaider, T., Soti, Cs, Prohaszka, Z & Nardai, G (1998) The 90 kDa molecular chaperones: structure, function and clinical applications A comprehensive...
- 8
- 392
- 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt
... GCATCAACCCCAAGACCAAATGG CGGGACGGTGTTGAGAGTGGA GAGAGTGGACCGGCACCAACA GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT ... TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA AAGAGCGACTTGCGGGTATG CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CAACAGGGAAAAGATGACACAGATC GGGACAGCACAGCCTGGAT ... qCXCa.fw1 qCXCa.rv1 qCXCb.fw1 qCXCb.rv1 q40S.fw1 q40S.rv1 qACT.fw1 qACT.rv1 T7 T3 GTGCGGATCTSTTCTTCACAC CACCGTCACAGATATGTACCATATAGTC GGTGGTCTTTTGCAGAGTCATTT TTCTTTAGATACTGCTGAAGCCA AGGTCTGCATCAACCCCAAG...
- 13
- 398
- 0
TRƯ NG . I H C AN GIANG KHOA NÔNG NGHI P - TÀI NGUYÊN THIÊN NHIÊNNGUY N TH HÒA HI PKH O SÁT M T SY UTMÔI TRƯ NG NƯ C, . CC AT OPHÂN LO I VÀ .ÁNH GIÁ N NG . NĂM 2005 - 2006TUY N SÔNG H U, T NH AN GIANGLU N VĂN T T NGHI P K SƯ NGÀNH PHÁT TRI N potx
... ñư c dùng r ng rãi ñ ñ c trưng cho hàm lư ng ch t h u c a nư c th i s ô nhi m c a nư c t nhiên COD ñư c ñ nh nghĩa lư ng oxy c n thi t cho trình oxy hóa hóa h c h p ch t h u c nư c COD cao ñ c ... n g c s kh c c a 47 h p ch t microcystin Trong ñó, 37 h p ch t ñư c trích li t hi n tư ng nư c n hoa nuôi c y phòng thí nghi m thu c dòng Microcystis, 15 h p ch t không t Microcystis, h p ch t ... K2Cr2O7 Lư ng Kalidicromat acid sulfuric s gia gi m tương ng v i lư ng ch t h u c m u Lư ng Dicromat dư s ñư c ñ nh phân b ng dung d ch FAS C c ph n ng hóa h c x y sau: CHC + Cr2O72- + H+ → CO2...
- 68
- 442
- 0
![jump start responsive web design - c. sharkie, a. fisher (sitepoint, 2013) [ecv] ww](https://media.store123doc.com/images/document/14/y/nq/small_nqk1399121707.jpg)
jump start responsive web design - c. sharkie, a. fisher (sitepoint, 2013) [ecv] ww
... suggests that a call to action changes priority once you’ve taken that action, or that a home page changes its content when there are changes to your physical location, as Web Directions South ... News across devices Device features are used by the media queries that can, in turn, direct which CSS is applied to your application Media queries assess the capability of a device; for instance, ... Viewing sitepoint.com across the tip of the iceberg In addition to changes in the device sizes that applications can appear on, there are also changes to how users interact with your applications...
- 153
- 550
- 0
Báo cáo sinh học: " Research Article Interactions between Uterine EMG at Different Sites Investigated Using Wavelet Analysis: Comparison of Pregnancy and Labor Contractions" pdf
... amplitude relation The first method is the wavelet local correlation coefficient (WLCC), which detects the phase correlation The second one is the cross wavelet coherence function (CWCF), which detects the ... typical computational costs are 0.12 ms per contraction for scalogram, cross-scalogram and phase synchronization, and 10 per contraction for WLCC and CWCF with the significance test The scalogram ... (3) at each surrogate, calculate WLCC between X and Ys then: WLCCsurr = WLCC(X, Ys), (4) the confidence limit for WLCC may be obtained from the tails of the WLCCsurr distribution, (5) the generated...
- 9
- 363
- 0
Báo cáo lâm nghiệp: " Production potential of Douglas fir at mesotrophic sites of Křtiny Training Forest Enterprise" ppsx
... spruce Spruce woody species larch Larch Woody species Dgl Dgl Spruce Spruce Larch Larch Woody species Fig The significance of differences in the production potential of Douglas fir, spruce and ... larch 1 39A1 2 122 Dgl 3, larch 373B12 V 123 25 Dgl 3, spruce 27, larch 41 37 3C1 2 124 Dgl 3, spruce 16, larch 29 55B13b 130 Dgl 5, larch 14 2C1 1 107 Dgl 1, spruce 30 17 3C1 1 106 Dgl 4, spruce 91 177B11 ... According to the hypothesis, Douglas fir can reach a height of 70 to 80 m at a sufficient rotation even under conditions of Central Europe 5.54 summary and conclusion The present paper evaluates...
- 12
- 433
- 0
Báo cáo khoa học: "Provenance variation in Pinus nigra at three sites in Northern Greece" ppt
... Corsica 287 ab 3.4 abc GR36 Aegion 257 abc 3.7 ab GR33 Sparta 248 abc 3.3 abc GR79 Lesbos 245 bc 3.3 abc IC08 Calabria 244 bc 3.1 bc TR.022 Adana 228 cd 224 cd 2.4 cd TR21 Balikesir 219 cd 215 cd ... 258 bcd 3.3 ab 91 bcd GR33 Sparta 256 bcd 3.3 ab 98 ab TR21 Balikesir 253 bcd 3.2 abc 96 abc TR.22 Adana 240 bcde 2.7 cd 93 bc GR35 Eubea 233 cd 3.0 bc 100 a 10 GR93 Katerini 233 cd 2.8 bc 98 ... differences to original site characteristics, facilitating wider applications MATERIALS AND METHODS The trial was established in 1986 on three sites Two in Anthrakia pilot plantation, Grevena district,...
- 8
- 213
- 0
Báo cáo khoa học: "Provenance variation in Pinus nigra at three sites in Northern Greece" pps
... croissance et de la production de matière sèche du maïs sous l’effet de l’ombrage de Eucalyptus tereticornis Schutz [13] a également observé une forte réduction de la germination de six espèces ... agriculture, Proc Indian Society of Weed Science International Symposium, Hisar, India, 18–20 November 1993, Vol II, Indian Society of Weed Science, Haryana, 1993, pp 52–55 [6] Diakité T., Concurrence ... Étude Socio-économique des Systèmes Parcs dans le Bassin Arachidier – Cas de Sterculia setigera et de Cordyla pinnata, mémoire de confirmation, DRPF-ISRA, Dakar, 1994 [10] Samba A.N.S., Influence...
- 9
- 212
- 0
Báo cáo khoa học: " Perforated mixed carcinoid-adenocarcinoma in transverse colon and at gastroenterostomy site: case report" pot
... recognized This tumor is reported under different names including goblet cell carcinoid (GCC), adenocarcinoid, mucinous carcinoid, intermediate type of carcinoid, crypt cell carcinoma, amphicrine ... gastroenterostomy site: case report World Journal of Surgical Oncology 2010 8:110 Conclusions This case with the characteristics of mixed carcinoidadenocarcinoma with carcinoid component, predominantly composed ... addition the surface mucosal epithelium is not neoplastic Histopathological features such as increased number of Paneth cells, increased amount of mucin secretion and presence of pancreatic polypeptide...
- 3
- 321
- 0
Báo cáo khoa học: "The synchronous occurrence of squamous cell carcinoma and gastrointestinal stromal tumor (GIST) at esophageal site" ppsx
... study and collect the clinical data FZ participated in the design of the study and collect the clinical data GCP participated in the design of the study and collect the clinical data JN carried ... collect the clinical data LR participated in the design of the study and collect the clinical data GP participated in the design of the study and collect the clinical data AZ participated in the design ... Microscopic examination of squamous cell carcinoma Microscopic examination of squamous cell carcinoma A) Esophagus infiltrative squamous cell carcinoma (H and E 10×); B) Esophagus infiltrative...
- 5
- 228
- 0
Genetic variation in growth, stem straightness, pilodyn and dynamic modulus of elasticity in secondgeneration progeny tests of Acacia mangium at three sites in Vietnam
... cattle manure ? 0.2 kg NPK kg cattle manure ? 0.2 kg NPK 0.5 kg micro-organic fertilizer ? 0.2 kg NPK Replicates 10 10 Rows/replicate 16 10 10 Columns per replicate 7 10 Trees per plot 3 Spacing ... (1992) Genetic parameters from a clonally replicated test of black spruce (Picea mariana) Can J For Res 22:24–36 Nambiar EKS, Harwood CE (2014) Productivity of acacia and eucalypt plantations in ... row, column, plot, family and residual variance–covariance matrices between trait i and j, denoting variance when i = j A is the additive genetic relationship matrix To ensure that the variance–covariance...
- 15
- 745
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... residue at 16 295 of the genome The 22-bp nucleotide sequence (16 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination ... observed at the downstream vector site corresponding to a CAA sequence motif (196 nt transcript) The significance of the termination at the latter downstream site remains unclear, although it corresponds ... to a CAA sequence motif similar to the upstream D-TERM site Transcription termination at the second CAA site, indicates the importance of this sequence motif in addition to AAUAAA sequence, in...
- 13
- 415
- 0
Ebook lập trình hướng đối tượng C++ của giáo sư Phạm Văn Ất
... gồm đĩa Sau c i đặt (giả sử vào thư m c C:\TC) thư m c TC gồm thư m c sau: C: \TC\BGI chứa tệp đuôi BGI CHR C: \TC\BIN chứa tệp chương trình (đuôi EXE) TC, TCC, TLIB, TLINK C: \TC\INCLUDE chứa tệp ... định CPP TC tệp chương trình c đuôi C Trong TC++ th c chương trình C C++ Để th c chương trình C cần dựng đuôi C để đặt tên cho tệp chương trình, để th c chương trình C+ + c n dựng đuôi CPP để ... hàm c ng c kh c C, nên yêu c u bắt bu c đ c giả C+ + phải biết sử dụng tương đối thành thạo ngôn ngữ C - Vì C+ + mở rộng C, nên thân chương trình C chương trình C+ + (chỉ c n thay đuôi C đuôi CPP)...
- 396
- 1,932
- 3
AN EXPLORATION ON THE EFFECTIVENESS OF PEER-EDITING TECHNIQUE IN TEACHING ESSAY WRITING AT FOREIGN LANGUAGES FACULTY, LHU
... among which accuracy is much clearer Accuracy 33 In this study, the level of accuracy means student’ ability to use standard English concerning grammar, sentence structure and mechanics and it ... and fluency and also a stimulating atmosphere is created in the classroom 8 CHAPTER 1: INTRODUCTION Feedback is widely seen in education as crucial for both encouraging and consolidating learning ... of accuracy and fluency 22 4.2 Peer -editing enhances students’ participation in the study 31 4.3 The use of Peer -editing technique in the classroom creates a positive atmosphere, necessary...
- 74
- 411
- 3
giáo trình lập trình c++ của thầy phạm văn ất chương 1
... ghi chỳ Trong C+ + c thể viết c c dũng ghi chỳ c c dấu /* */ C Cách cho phộp viết c c ghi chỳ trờn nhiều dũng trờn dũng Ngoài C+ + c n cho phộp viết ghi chỳ trờn dũng sau dấu gạch chộo, vớ dụ: ... trỡnh c u tr c - Tư tưởng lập trỡnh c u tr c tổ ch c chương trỡnh thành c c chương trỡnh Trong PASCAL c kiểu chương trỡnh thủ t c hàm Trong C cú loại chương trỡnh hàm Hàm đơn vị chương trỡnh đ c ... cho phép triển khai phương pháp lập trỡnh c u tr c Một chương trỡnh c u tr c gồm c c cấu tr c liệu (như biến, mảng, ghi) hàm, thủ t c Nhiệm vụ vi c tổ ch c thiết kế chương trỡnh c u tr c tổ chức...
- 16
- 1,266
- 19
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose