0

9 fas fas l and release of cyt c

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Báo cáo khoa học

... Christiano AM, Kahari VM, Bashir MM & Rosenbloom J ( 199 1) Molecular biology and pathology of human elastin Biochem Soc Trans 19, 824–8 29 Debelle L & Tamburro AM ( 199 9) Elastin: molecular description ... in elastin, is chemotactic for fibroblasts and monocytes J Cell Biol 99 , 870–874 50 Kamoun A, Landeau J-M, Godeau G, Wallach J, Duchesnay A, Pellat B & Hornebeck W ( 199 5) Growth stimulation of ... epithelial cells and processes various ECM constituents, such as collagens, gelatin, and laminin, and also non-ECM proteins, including pro-tumor necrosis factor-a and a2-macroglobulin [2] MMP -9 (gelatinase...
  • 18
  • 428
  • 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học

... TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ... GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA CGGTGGAGACAACAAGGACT TGCGTTTCGTTTGACTTCAC GGCTGATGGCTTCTCAAAAC Hemolymph titers of PO-CHH and ES-CHH in ... 214–2 19 39 Chen SH, Lin CY & Kuo CM (2005) In silico analysis of crustacean hyperglycemic hormone family Mar Biotechnol 7, 199 –206 40 Fanjul-Moles ML (2006) Biochemical and functional aspects of crustacean...
  • 12
  • 474
  • 0
Báo cáo y học:

Báo cáo y học: "Tumor necrosis factor alpha-dependent aggrecan cleavage and release of glycosaminoglycans in the meniscus is mediated by nitrous oxide-independent aggrecanase activity in vitro" pptx

Báo cáo khoa học

... CAG GCT Collagen type I S AAT TCC AAG GCC AAG AAG CAT G Collagen type I AS GGT AGC CAT TTC CTT GGT GGT T Collagen type II S AAG AAG GCT CTG CTC ATC CAG G Collagen type II AS TAG TCT TGC CCC ACT ... ACT TAC CGG T MMP-1 S GGA CTG TCC GGA ATG AGG ATC T MMP-1 AS TTG GAA TGC TCA AGG CCC A MMP-2 S GTA CGG GAA TGC TGA CGG GGA ATA MMP-2 AS CCA TCG CTG CGG CCT GTG TCT GT MMP-3 S CAC TCA ACC GAA CGT ... 215:171-1 79 Pratta MA, Yao W, Decicco C, Tortorella MD, Liu RQ, Copeland RA, Magolda R, Newton RC, Trzaskos JM, Arner EC: Aggrecan protects cartilage collagen from proteolytic cleavage J Biol Chem...
  • 9
  • 426
  • 0
Báo cáo y học:

Báo cáo y học: " Legionella pneumophila infection induces programmed cell death, caspase activation, and release of high-mobility group box 1 protein in A549 alveolar epithelial cells: inhibition by methyl prednisolone" pot

Báo cáo khoa học

... growth and cytotoxicity of L pneumophila in A5 49 alveolar epithelial cells We also investigated the mechanisms of apoptosis of L pneumophila-infected A5 49 cells, including nuclear deoxyribonucleic ... effect of L pneumophila on A5 49 cells Cytotoxic Cytotoxic effect of L pneumophila on A5 49 cells A5 49 cells were infected with L pneumophila virulent AA100jm and avirulent dotO mutant strains LDH ... manufacturer The level of specific cytotoxicity was calculated by the following formula: % of specific LDH release = ([experimental LDH release the mean of negative control release] /[the mean of...
  • 10
  • 354
  • 0
Unit 9 Getting started L and R (pp)

Unit 9 Getting started L and R (pp)

Tiếng anh

... along the coast of Thanh Hoa The south – central coast can expect thunderstorms Hue will experience temperatures between 25 0C and 30 0C There will also be thunderstorm over the central highlands ... highlands Areas around the Cuu Long Delta can expect clouds during the day Ho Chi Minh City’s temperatures will be between 27 0C and 35 0C Thuy: That’s all, Grandma Grandma: Thank you, dear What ... 35 0c – 37 0c The south – central coast/ be/ rain  The south – central coast will be raining The Cuu Long Delta/ thunderstorms  The Cuu Long Delta will be thunderstorms III.HOMEWORK - Learn by...
  • 12
  • 251
  • 0
Guidelines for the rehabilitation and release of vervet monkeys

Guidelines for the rehabilitation and release of vervet monkeys

Tổng hợp

... et al Sapajus apella) et al 2001 Hylobates lar Rickettsia conori et al et al 2007) and et al 56 - Vervet monkey rehabilitation - c c c c c. 11% c. 4% - - c c c c c. 5% Rhus chirindensis (Ficus Venter ... Biol Conserv (Chlorocebus aethiops - Conserv Biol 14: 1317–1326 Occ Pap IUCN Species Sur aethiops vival Commission 61 Chlorocebus Acta Theriol 47: 113–124 Guy and Curnoe Ecol Environ Callimico ... et al - (Guy et al et al Release site selection - - et al - - et al et al ) Papio ursinus, Galago moholi, chacma Cercopithecus mitis, et al et al et al Guy 2013) Procolobus gordonorum, and chimPan...
  • 10
  • 305
  • 0
Insights into solid phase characteristics and release of heavy metals and arsenic from industrial sludge via combined chemical, mineralogical, and microanalysis

Insights into solid phase characteristics and release of heavy metals and arsenic from industrial sludge via combined chemical, mineralogical, and microanalysis

Báo cáo khoa học

... samples were digested by HNO3conc, HClO4conc, and HFconc in a Teflon beaker on a hot plate All glassware was first rinsed with HNO3 0.5 mol /L and all reagents were of analytical grade Total concentrations ... leachability of HMs and As from CLT (cumulative leachability) and pHstat leaching tests (leachability at 96 h): Group Element leachability is higher in the pHstat leaching test than in the CLT ... The leachability of Zn, Ni, and Cu is negligible (
  • 14
  • 339
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The role of photoperiod and temperature in the induction and the release of dormancy in Pinus sylvestris L. seedlings" potx

Báo cáo khoa học

... units Conclusions All conditions provided during seedling development may influence its later degree of bud dormancy Deepest dormancy is reached after a long growth period with short night followed ... fascicles secondary needles (Dormling et al., = 197 7; Dormling, 198 6) The normal winter dormancy of Scots pine, however, includes a rest phase which is broken by exposure to cold (Romberger, 196 3) The ... readily after exposure to growing conditions More than 20 cycles with long nights completely change the growth habit from the juvenile stage with primary needles to the stage with needle fascicles...
  • 5
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: "Fas (CD95) induces rapid, TLR4/IRAK4-dependent release of pro-inflammatory HMGB1 from macrophages" pot

Báo cáo khoa học

... volume of ml/well in a 6-well tissue culture plate Cell culture and treatment The murine mϕ cell line RAW264.7 (American Type Cell Collection, Rockville, MD, USA) and primary murine peritoneal ... less than 0.25 EU/ml Cell viability assay Cell viability was determined by trypan blue exclusion using a Vi-Cell XR Cell Analyzer (Beckman Coulter, CA, USA) Preparation of cellular extracts Cells ... stimuli, such as LPS [ 29] To determine if Fas induces HMGB1 cytoplasmic translocation, murine peritoneal mϕ were collected following incubation with mFasL (0 - 0.5 l/ ml) for hr Cytoplasmic and...
  • 8
  • 160
  • 0
Báo cáo y học:

Báo cáo y học: " Anti-Fas mAb-induced apoptosis and cytolysis of airway tissue eosinophils aggravates rather than resolves established inflammation" docx

Báo cáo khoa học

... h All animals were sacrificed by ip injection of pentobarbital immediately followed by bronchoalveolar lavage (BAL) and dissection of the lungs and tracheobronchial airways Bronchoalveolar lavage ... effects of glucocorticoids on human eosinophils J Allergy Clin Immunol 199 4, 94 (6 Pt 2):1202-1213 Uller L, Andersson M, Greiff L, Persson CG, Erjefalt JS: Occurrence of apoptosis, secondary necrosis, ... already established eosinophilic inflammation Importantly, we have included a detailed transmission electron microscopy analysis to assess cell phenotypes such as apoptotic and cytolytic cells...
  • 14
  • 137
  • 0
Báo cáo y học:

Báo cáo y học: " Increased serum soluble Fas after major trauma is associated with delayed neutrophil apoptosis and development of sepsis" pot

Báo cáo khoa học

... [12], and the procession by a matrix metalloproteinase results in protein cleavage and release of the extracellular domain [15] The biologically active soluble form of FasL (sFasL) as well as ... under curve; ERK: extracellular signal-regulated kinase; FasL: Fas ligand; FCS: fetal calf serum; GM-CSF: granulocyte macrophage colonystimulating factor; ICU: intensive care unit; IL: interleukin; ... Kuligowski M, Kitching A, Hickey M: Leukocyte recruitment to the inflamed glomerulus: A critical role for platelet-derived P-selectin in the absence of rolling J Immunol 2006, 176: 699 1- 699 9 Brown KA,...
  • 10
  • 324
  • 0
Release of anti-cyanobacterial allelochemicals from aquatic and terrestrial plants applicable for artificial floating islands

Release of anti-cyanobacterial allelochemicals from aquatic and terrestrial plants applicable for artificial floating islands

Sinh học

... artificial floating islands releases anti-cyanobacterial allelochemicals and to identify such fascinating compounds MATERIALS AND METHODS Plants and cyanobacterium Commercially obtained umbrella plant ... the release of anti-cyanobacterial allelochemicals In order to confirm the release of anti-cyanobacterial allelochemicals, the culture solution of each plant was subjected to a solid extraction ... indicate standard deviation (n=3) Analysis of allelochemicals Although no paper has reported the identified anti-cyanobacterial allelochemicals released from C alternifolius, certain species of Cyperaceae,...
  • 9
  • 494
  • 0
Effect of Coagulant on Phosphorus Uptake and Release in EBPR Process

Effect of Coagulant on Phosphorus Uptake and Release in EBPR Process

Môi trường

... Enhanced biological phosphorus removal in a semi full-scale SBBR, Wat Sci Tech., 43(3), 167-174 Cech J S and Hartman P ( 199 0) Glucose induced breakdown of enhanced biological phosphorus removal, ... electrolytic conditions for the electrochemical elution of iron as applied to phosphorus removal technology, Journal of Japan Society on Water - 391 - Journal of Water and Environment Technology, ... Environmental biotechnology: principles and applications, McGraw-Hill, New York Tasli R., Artan N and Orhon D ( 199 7) The influence of different substrates on enhanced biological phosphorus removal in...
  • 10
  • 531
  • 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 9 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 9 pptx

Ngư nghiệp

... 300 and 500 µm for small water fleas and smaller species of cyclopoid copepods; · 700 µm for adult water fleas of the Daphnia genus, large species of cyclopoid and calanoid copepods, larvae and ... fully controlled, Kuhlmann et al ( 198 1) estimated the capacity of his 24 m³ copepod culture and came to the conclusion that this capacity should be sufficient to feed a batch of 4000 freshly-hatched ... other, and this process is called succession The first blooming organism will usually be the diatom group, that will soon collapse due to depletion of silicates (only in closed systems: pond and...
  • 30
  • 542
  • 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Báo cáo khoa học

... et al Characterization of the binding of PCSK9 to intact cells levels of plasma LDL cholesterol, whereas loss -of- function mutations are associated with low levels of plasma LDL cholesterol [1,8–12] ... IC50 (nM) Kd (nM) Labeled PCSK9 Competitive ligand High Low High Low [125I]TC-PCSK9 [125I]TC-PCSK9 [125I]TC-PCSK9 [125I]TC-PCSK9-D374Y PCSK9-wild type (3) PCSK9-S127R (1) PCSK9-D374Y (1) PCSK9-D374Y ... Radiolabeling of proteins We initially attempted to investigate the binding of PCSK9 to HepG2 cells using PCSK9 directly labeled with 125I 294 6 HepG2 cells (European Collection of Cell Cultures,...
  • 13
  • 712
  • 0
Tài liệu A General History and Collection of Voyages and Travels, Vol. 9 ppt

Tài liệu A General History and Collection of Voyages and Travels, Vol. 9 ppt

Khoa học xã hội

... our first landing, and indeed at all places to which we came in the whole country, the children and low idle people used to gather about and follow us a long way, calling _coré, coré, cocoré, Waré_ ... Isle of Pigmies. E.] §14 Note of Commodities vendible in Japan.[50] Broad-cloths of all sorts, as black, yellow, and red, which cost in Holland eight or nine gilders the Flemish ell, two ells and ... grievously wounded, that it is thought Palmer will hardly escape with his life, and that Marnell will be lame of his hands for life The 9th I went aboard ship early, and called the master and all the...
  • 298
  • 469
  • 0
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

Báo cáo khoa học

... nonliganded structure of Bacillus glutaminase the displacement of all the backbone atoms of Mglu and Bacillus glutaminase induced by ligand binding Mglu shows no significant conformational change ... studies of salt-tolerant glutaminase from Micrococcus luteus K-3 Acta Crystallogr D Biol Crystallogr 59, 566–568 33 Leslie AGW ( 199 2) Recent changes to the MOSFLM package for processing film and image ... that the catalytic mechanism of Mglu is similar to the proposed catalytic mechanism of Bacillus glutaminase [5] The structure of Bacillus glutaminase that covalently binds 5-oxo -l- norleucine (PDB...
  • 11
  • 521
  • 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học

... application to staphylococcal nuclease Biochemistry 28, 897 2– 897 9 47 Boyd J, Hommel U & Campbell ID ( 199 0) Influence of cross-correlation between dipolar and anisotropic chemical-shift relaxation ... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... magnetic-resonance relaxation in macromolecules Analysis of experimental results J Am Chem Soc 104, 45 59 4570 Clore GM, Driscoll PC, Wingfield PT & Gronenborn AM ( 199 0) Analysis of the backbone...
  • 17
  • 490
  • 0
Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Báo cáo khoa học

... Reh, M & Schlegel, H.G ( 199 7) Location, catalytic activity, and subunit composition of NAD-reducing hydrogenases of some Alcaligenes strains and Rhodococcus opacus MR22 Arch Microbiol 167, 172–176 ... Bagley, K.A ( 199 7) Biological activation of hydrogen Nature 385, 126 De Lacey, A .L. , Hatchikian, E .C. , Volbeda, A., Frey, M., Fontecilla-Camps, J .C & Fernandez, V.M ( 199 7) Infrared spectroelectrochemical ... Garcia, E., Piras, C. , De Lacey, A .L. , Fernandez, V.M., Hatchikian, E .C. , Frey, M & Fontecilla-Camps, J .C ( 199 6) Structure of the [NiFe] hydrogenase active site: Evidence for biologically uncommon...
  • 8
  • 371
  • 0
Báo cáo khoa học: The metabolic role and evolution of L-arabinitol 4-dehydrogenase of Hypocrea jecorina potx

Báo cáo khoa học: The metabolic role and evolution of L-arabinitol 4-dehydrogenase of Hypocrea jecorina potx

Báo cáo khoa học

... E coli To this end, the lad1 coding region was PCR amplified from cDNA using primers GEX-Lad fwd (5¢-GC AATTCACAGGGATCCATGTCGCCTTCC-3¢) and GE X-Lad rv3 (5¢-CTTGGTCGCAGCGGCCGCTCAATCC AGG-3¢) PCR ... for D-allitol from Omicron Biochemicals, Inc (South Bend, IN), and L- mannitol and D-talitol from SACHEM s.r.o (Praha, CZ) Large scale production of hexitols and hexuloses by Lad1 Conversion of the ... enzymatic reaction of Lad1 and could also be due to an indirect effect of lad1 knockout on the regulation of other genes On the other hand, the lack of growth of the wildtype strain on D-allitol and...
  • 9
  • 422
  • 0

Xem thêm