892 two synchronizers for the same asynchronous input a logic diagram b

Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx

... (2001), #N9 Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R ... 60, and 31t − 738 ≤ i ≤ 31t + 799) Now we deﬁne these Bi ’s These subgraphs all have a common vertex x, otherwise their vertex sets are pairwise disjoint For 7t+1 ≤ i ≤ t − 742, let the subgraph ... On the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers...

6
477
0

Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens

Danh mục: Môi trường

... Shigenaga, M.K., Aboujaoude, E.N., Cheon, Q and Ames, B. N (1994) Assays of oxidative DNA damage biomarkers 8-oxo-2-deoxyguanosine and 8-oxoguanine in nuclear DNA and biological fluides by high-performance ... detect a variety of mutagens that were not detected in the standard tester strains They are suitable for mutagenicity of aromatic hydrocarbons, allyl hydrocarbons and insecticides, but not suitable ... 3-methylcholathrene not only by rat liver S9 fraction but also by human liver S9 fraction These results suggest that most mutagens could be activated to the ultimate forms in the presence of a mammalian...

6
735
0

Tài liệu Decision Analysis and Risk Management: Two Sides of the Same Coin pdf

Danh mục: Quản trị mạng

... could be a radiation leak at work Analytical Bias – my mother had a hip problem and therefore this is probably the same thing, only worse Step 2: Formulating Choices: Go to family physician, go ... it possible that there are custom-made vehicles that would provide the best value? c Analytical bias – Why did I ignore the Eastern European brands? Comparative Analysis a Known unknowns – Have ... Page It follows that the better our information and the more balanced and thorough the analysis, the higher can be the quality of our decisions Better decisions are informed, reasoned, and balanced...

9
573
0

Enterprise Two English for the commercial world - Tiếng Anh trong thương mại potx

Danh mục: Cao đẳng - Đại học

...

182
747
4

iec 61131-8 programmable controllers - guidelines for the application and implementation of programming languages

Danh mục: Điện - Điện tử

... IEC:2003(E) a) a variable declared in a VAR _INPUT declaration; b) a variable declared in a VAR_IN_OUT declaration; c) an external variable In each example in Figure 10, the interface definition of a block ... a function block instance can be declared as a global variable in a program , and the function block instance name can then be used as an external variable in function blocks of other types Although ... declares the data type to be used for each variable The selection of a type for a variable should be appropriate to the range of values and operations to be performed on the variable For instance,...

112
618
4

Báo cáo toán học: "On Kadell’s two Conjectures for the q-Dyson Product" pot

Danh mục: Báo cáo khoa học

... the u’s and the v’s be not paired up Some of the cases can be established by applying the operator π deﬁned in Section to our main theorem But not all the un-paired up cases can be obtained in ... can be done by writing it as a linear combination of some ﬁrst layer coeﬃcients of the q-Dyson product, and then applying the formulas of [8] Unfortunately, we are not able to derive a nice formula ... 1 +a ai1 −ai2 This is actually a linear system having no solutions, so our ﬁrst hope broke Looking closer at (4.4), we see that the ﬁrst two equalities must be satisﬁed to have a nice formula Agreeing...

15
265
0

ĐÔI BỜ - WE ARE TWO BANKS OF THE SAME RIVER ! (09/11/2011)

Danh mục: Tiếng anh

...

21
822
0

An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot

Danh mục: Sức khỏe người cao tuổi

... responsible Butler thereby allows the practitioner to maintain a database on all of the users’ daily emotional information It also includes an alarm system, which sends a warning to the professional ... section can be accessed at any time for their Book of Life or for e-mails sent via Butler Navigating the Internet Access to the network has been adapted so users can easily access a search Web ... each of the three levels of implementation (diagnostic application, therapeutic application, playful application) The system features collaborative multimedia technology with the Internet as a...

8
733
0

Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Danh mục: Ngân hàng - Tín dụng

... by 2008 losses a) Based on banks contained in respective countries' Datastream bank indices Note that such data are not available for Saudi Arabia b) From 1-Jan-10 to 29-Jul-10 c) Based on banks ... TOPIX BONDS: JPM EMBI GLOBAL MIDDLE EAST JPM EMBI GLOBAL ASIA JPM EMBI GLOBAL AFRICA JPM EMBI GLOBAL COMPOSITE JPM EMBI GLOBAL LATIN AMERICA JP BENCHMARK 10 YEAR DS GOVT. INDEX EMU BENCHMARK ... this option is not available at a national level As inflation cannot deviate too much from euro-wide inflation, a real devaluation, i.e deflation, would be warranted But this could trigger a detrimental...

18
384
0

báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx

Danh mục: Hóa học - Dầu khí

... not allow for a clean estimate of per-act transmission probability but only for a per-time-period transmission probability Both Eaton et al [11] and Goodreau et al [27] used these estimates as ... realistic biological and behavioural scenarios for various sub-Saharan African populations Sawers and Stillwaggon’s argument that the concurrency models of Morris and Kretzschmar only find an effect ... of the world’s greatest public health crises Acknowledgements The author thanks Aditya Khanna, Susan Cassels and the two anonymous reviewers for their valuable feedback and assistance with the...

7
459
0

báo cáo hóa học:" Research Article Resource Allocation for the Multiband Relay Channel: A Building Block for Hybrid Wireless Networks" ppt

Danh mục: Hóa học - Dầu khí

... than one band available for the link between the relay and the destination, then only the best band among them will be used This can be seen by ﬁxing the overall band for this link and performing ... where Ps and Pr are the total available power at the source and relay node αi and ζi are the nonnegative power allocation parameters for each orthogonal band at the source and relay node, and m ... frequency bands available from the source and the relay are mutually orthogonal In particular, the situation where, among total k channels, there are m channels available for the source node and k...

13
305
0

Báo cáo hóa học: " Research Article Inequalities for the Polar Derivative of a Polynomial" pot

Danh mục: Hóa học - Dầu khí

... derivative,” Journal of Mathematical Analysis and Applications, vol 336, no 1, pp 171–179, 2007 11 A Aziz, “Inequalities for the derivative of a polynomial,” Proceedings of the American Mathematical Society, ... Dewan, J Kaur, and A Mir, “Inequalities for the derivative of a polynomial,” Journal of Mathematical Analysis and Applications, vol 269, no 2, pp 489–499, 2002 13 K K Dewan, N Singh, and A Mir, ... “Inequalities for a polynomial and its derivative,” Journal of Approximation Theory, vol 54, no 3, pp 306–313, 1988 10 B Chanam and K K Dewan, “Inequalities for a polynomial and its derivative,”...

9
220
0

Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc

Danh mục: Báo cáo khoa học

... latency [17] The arithmetic units are realized by using combinational logic, meaning that all calculation operations are performed in parallel The schematic diagram of its FPGA implementation is given ... implementation (SCI) and (b) the multicycle implementation (MCI) Tm is the multiplication time of a two- input 16-bit multiplier, Ta is the addition time of a two- input 16-bit adder, whereas Ts is the ... calculation time This fact makes them unsuitable for realtime analysis, and severely restricts their application Hardware implementations, when they are possible, can overcome this problem and...

18
385
0

Báo cáo hóa học: " The Cramer-Rao Bound and DMT Signal Optimisation for the Identiﬁcation of a Wiener-Type Model" pptx

Danh mục: Báo cáo khoa học

... Table 2: Result of the estimation comparison for optimal and suboptimal input signals of Figure 19 for the identiﬁcation of the Wiener-type model of Table Mean variance for optimal signal Mean ... signal can lead not only to very high Cramer-Rao bounds but even to biased estimates These biased estimates are caused by the practical problem that, for these special phase sets ϕ, the Hessian matrix ... number of members The determination of the optimal excitation signal from this subclass can now be tackled by a complete search over all members of the subclass A realistic subclass is the class...

14
294
0

Báo cáo toán học: "Lower Bounds for the Average Genus of a CF-graph" doc

Danh mục: Báo cáo khoa học

... 1: AaBbCa− Db− E ∼ ADCBEaba− b Proof By Property 2.1, AaBbCa− Db− E ∼ Db− EabCBa− A = EabCBa− ADb− ∼ ba− ADCBb− Ea ∼ a b EADCBab = aba− b EADCB ∼ aba− b ADCBE Relation is also called handle ... ∼ A, Operation 2: AabBab ∼ AcBc, Operation 3: AB ∼ {(Aa), (a B) }, a A A a b c A B a b a A B A B A c c B c Figure 4: Operation 1, Operation and Operation (From left to right) where A and B are ... normalization, In the above relation, A, B and C are permitted to be empty By Relation 1, we can obtain the normal form of an orientable surface as one, and only one, of O0 = aa− , Om = m bi a b ...

14
386
0

Báo cáo y học: "Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" docx

Danh mục: Báo cáo khoa học

... meeting, participants filled out the knowledge test (Additional File 1) about dementia management and an evaluation form [33] Study arm A and B All participants were asked to complete a further knowledge ... and evaluation was completed in September 2008 Cluster randomisation took place at QC level (two arms) Stratified randomisation was performed by a statistician separately for small and large QCs ... medical associations, but only received the information of the specialisation of a QC at the first phone call The consequence was that many QCs moderators refused to participate at that time because...

10
418
0

báo cáo khoa học: " Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" potx

Danh mục: Báo cáo khoa học

... meeting, participants filled out the knowledge test (Additional File 1) about dementia management and an evaluation form [33] Study arm A and B All participants were asked to complete a further knowledge ... and evaluation was completed in September 2008 Cluster randomisation took place at QC level (two arms) Stratified randomisation was performed by a statistician separately for small and large QCs ... medical associations, but only received the information of the specialisation of a QC at the first phone call The consequence was that many QCs moderators refused to participate at that time because...

10
346
0

Báo cáo khoa học: "Verification of the Combimatrix influenza detection assay for the detection of influenza A subtype during the 2007–2008 influenza season in Toronto, Canada" pot

Danh mục: Báo cáo khoa học

... the Combimatrix and Luminex testing, RY and AE carried out the Combimatrix testing, JB assessed assay design, SB analyzed the data and wrote the manuscript, SJD conceived the idea for the study ... RVP assay, the sensitivity of the CombiMatrix influenza detection system for the detection of an influenza A subtype (either H1 or H3) was 95.2% (Table 1) All 16 specimens characterized as H3 by ... Canada) Total nucleic acid was extracted from each specimen using the easyMag automated extraction system (bioMérieux, Montreal, Canada) as per the manufacturer's protocols To control for extraction...

3
246
0

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Danh mục: Báo cáo khoa học

... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... regulated by PMA In our transcriptional profiling data, PMA treatment and cyclin T1 knock-down are two major variables in the RNA samples The microarray data were therefore analyzed to determine the ... studied area for decades, the regulation of transcription elongation has not been as actively investigated until recent years when a number of transcription elongation factors have been identified...

16
178
0

Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt

Danh mục: Báo cáo khoa học

... study AIM participated in the acquisition and analysis of data and participated in drafting and editing the manuscript AOT and RS managed the data collection and analysis JC participated in the ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human ... first public health benchmark for PA programmes established by the PAHB [14] Particularly with regards to PA programmes for the elderly, some organizations have reinforced the importance and strength...

30
369
0

892 two synchronizers for the same asynchronous input a logic diagram b possible ti

892 two synchronizers for the same asynchronous input a logic diagram b possible ti