65 patients 43 developed leg pain in a period of gt 12 months only 11patients 9 3 developed leg pain in a period of lt 1 month
báo cáo hóa học:" Non-invasive interactive neurostimulation (InterX™) reduces acute pain in patients following total knee replacement surgery: a randomised, controlled trial" potx
... post-operative pain medications in a procedure of this magnitude, is to stay ahead of the pain and so standard administration of pain medicines at regular intervals are administered by hospital staff ... Science Mechanisms and Clinical Effectiveness Journal of Pain 20 03, 4 (3) :1 09 -12 1 24 Melzack R: Prolonged relief of pain by brief, intense transcutaneous somatic stimulation Pain 19 7 5, 1 :35 7 -37 3 25 Gorodetskyi ... reporting only mild pain and no patients reporting being pain free Overall, at the Final pre-treatment measure, only three patients in the InterX group had a higher pain score than at Baseline compared...
- 11
- 337
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA -3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA -3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA -3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA -3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA -3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA -3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA -3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA -3' ... 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA -3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA -3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA -3' T7 5'-TAATACGACTCACTATAG -3' siRNA3 (binding in the coding region of...
- 8
- 576
- 0
Báo cáo y học: "Psychosocial factors and their predictive value in chiropractic patients with low back pain: a prospective inception cohort study" docx
... 0. 63 2.07* 1. 22 0.76 1. 71 1. 89 0 .11 – 3. 01 1. 19 – 3. 38 0. 49 – 2. 71 0 .36 – 1. 66 0. 69 – 4.57 0. 89 – 3. 61 0 .37 1. 78 0 .92 1 .96 3. 42* 2 .37 * 0.06 – 1. 67 0.84 – 3. 73 0 .34 – 2. 19 0.45 – 11 .27 1. 00 – 12 . 86 ... back pain Spine 19 9 9, 24( 23) :2 497 -2505 Page of (page number not for citation purposes) Chiropractic & Osteopathy 2007, 15 :5 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 ... pain in primary care: a prospective study BMJ 19 9 9, 31 8(7 19 9 ) :16 62-7 Macfarlane G, Jones GT, Hannaford PC: Managing low back pain presenting to primary care: where we go from here? Pain 2006, 12 2 (3) :2 19 - 222...
- 7
- 286
- 0
Báo cáo y học: "Feasibility of the STarT back screening tool in chiropractic clinics: a cross-sectional study of patients with low back pain" docx
... D, Main CJ: A FearAvoidance Beliefs Questionnaire (FABQ) and the role of fear- avoidance beliefs in chronic low back pain and disability Pain 19 9 3, 52 :15 7 -16 8 10 Swartzman LC, Gwadry FG, Shapiro ... resonance imaging and low back pain in adults: a diagnostic imaging study of 40-year-old men and women Spine 2005, 30 :11 73- 11 80 Molano SM, Burdorf A, Elders LA: Factors associated with medical careseeking ... Risk n = 1 39 High Risk n = 54 < weeks 32 34 17 - months 34 36 44 > months 34 30 39 > 30 days LBP preceding year, % 51 59 76 < 01 Leg pain, % 26 64 69 < 01 Number of LBP days during the last weeks,...
- 7
- 359
- 0
Báo cáo y học: "Application of a Diagnosis-Based Clinical Decision Guide in Patients with Low Back Pain" pdf
... measured on an 11 -point numerical pain rating scale Pain 20 01, 94 (2) :1 49- 15 8 Cox JM: Low back pain: mechanisms, diagnosis and treatment, 6th edn Baltimore: Williams and Wilkens; 19 9 9 Gudavalli MR, ... neck and back pain by anatomic pain patterns Spine 20 03, 28(2) :16 1 -16 6 Depalma MJ, Ketchum JM, Saullo T: What is the source of chronic low back pain and does age play a role? Pain Med 2 011 , 12 ( 2):224- 233 ... 12 ( 2):224- 233 Maigne JY, Aivaliklis A, Pfefer F: Results of sacroiliac joint double block and value of sacroiliac pain provocation tests in 54 patients with low back pain Spine (Phila Pa 19 7 6) 19 9 6, 21( 16) :18 89- 1 892 ...
- 33
- 395
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... Lancet 19 9 9, 35 3 :1 29 8- 13 0 3 Shahin H, Walsh T, Sobe T, Lynch E, King MC, Avraham KB, Kanaan M: Genetics of congenital deafness in the Palestinian population: multiple connexin26 alleles with shared ... wt/c. 235 delC wt/c. 235 delC IVS1+1G >A/ wt IVS1+1G >A/ wt wt/wt No Han IVS1+1G >A, c .11 G >A( G4D)/ c.9G >A( W3X) IVS1+1G >A, c .11 G >A (G4D)/wt wt/c.9G >A( W3X) 23 No Uyghur IVS1+1G >A/ c .35 delG No blood sample ... DT: Mapping and characterization of the basal promoter of the human connexin26 gene Biochim Biophys Acta 19 9 8, 1 4 43: 1 69- 18 1 Houseman MJ, Ellis LA, Pagnamenta A, Di WL, Rickard S, Osborn AH, Dahl...
- 7
- 695
- 0
Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx
... 97 :11 14- 11 23 Harada M, Mitsuyama K, Yoshida H, Sakisaka S, Taniguchi E, Kawaguchi T, Ariyoshi M, Saiki T, Sakamoto M, Nagata K, et al: Vascular endothelial growth factor in patients with rheumatoid ... morbidity and mortality J Exp Med 2006, 2 03: 14 47 -14 58 Page of 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Shapiro N, Schuetz P, Yano K, Sorasaki M, Parikh SM, Jones AE, Trzeciak S, Ngo L, Aird ... were Alves et al Journal of Translational Medicine 2 011 , 9: 23 http://www.translational-medicine.com/content /9/ 1/ 23 Page of Time-course of sFlt -1 and VEGF -A expression in FN At the time of fever...
- 8
- 491
- 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc
... life and diabetes Diabetes Metab Res Rev 19 9 9, 15 :205- 218 Page of (page number not for citation purposes) Health and Quality of Life Outcomes 20 09, 7: 19 10 11 12 13 14 15 16 17 18 19 20 21 22 23 ... http://www.hqlo.com/content/7 /1/ 19 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 severity influence diabetes patients' treatment priorities and self-management J GenIntern Med 2007, 22 (12 ) :1 635 -16 40 Alderman MH: ... (26 .99 ) 74.25 (26.78) 66. 83 ( 43. 91 ) 82.52 (35 .08) 62.45 (44.46) 68.06 (44 .92 ) 69. 21 ( 21. 25) 72. 79 (17 .88) 65. 68 (18 .33 ) 66 .35 (20. 83) 43. 45 (11 .38 ) 45. 51 (9. 52) 35 .30 *** (10 .50) 35 . 93 *** (11 .07)...
- 7
- 458
- 0
Báo cáo hóa học: " Associations between disease severity, coping and dimensions of health-related quality of life in patients admitted for elective coronary angiography – a cross sectional study" pdf
... disease Br Heart J 19 9 3, 69( 5):460-466 Page 11 of 12 (page number not for citation purposes) Health and Quality of Life Outcomes 2008, 6 :38 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Anderson ... copinge Perception of living with angina pectoris Overall quality of life Mean (SD) % 61. 7 (10 .2) 26 74 16 7 23 718 47 33 21 735 33 45 22 89 538 7 51 7 51 752 10 26.8 (4.2) 19 13 51 18 Determinants ... (25 .1) 58 .1 ( 19 . 4) 1. 44 (0. 61) 2 .17 (0.54) 0. 89 (0.57) 3 .9 (1. 4) 3. 2 (1 .3) a Canadian Cardiovascular Society classification York Heart Association c Angiographic diameter stenosis of at least...
- 12
- 463
- 0
báo cáo hóa học:" Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pdf
... 97 :11 14- 11 23 Harada M, Mitsuyama K, Yoshida H, Sakisaka S, Taniguchi E, Kawaguchi T, Ariyoshi M, Saiki T, Sakamoto M, Nagata K, et al: Vascular endothelial growth factor in patients with rheumatoid ... morbidity and mortality J Exp Med 2006, 2 03: 14 47 -14 58 Page of 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Shapiro N, Schuetz P, Yano K, Sorasaki M, Parikh SM, Jones AE, Trzeciak S, Ngo L, Aird ... were Alves et al Journal of Translational Medicine 2 011 , 9: 23 http://www.translational-medicine.com/content /9/ 1/ 23 Page of Time-course of sFlt -1 and VEGF -A expression in FN At the time of fever...
- 8
- 856
- 0
báo cáo hóa học:" The value of SPECT in the detection of stress injury to the pars interarticularis in patients with low back pain" doc
... Athletic Training 19 9 8, 33 (4) :35 1 -35 8 30 Takemitsu M, Rassi G, Woratanarat P, Shah S: Low back pain in pediatric athletes with unilateral tracer uptake at the pars interarticularis on single photon ... 25(6) :6 53 -657 13 Weir MR, Smith DS: Stress reaction of the pars interarticularis leading to spondylolysis A cause of adolescent low back pain Journal of Adolescent Health Care 19 8 9, 10 (6):5 73- 577 14 ... what age does low back pain become a common problem?: A study of 29, 424 individuals aged 12 - 41 years Spine 19 9 8, 23: 228- 234 Bernstein R, Cozen H: Evaluation of back pain in children and adolescents...
- 6
- 447
- 0
báo cáo hóa học:" Health-related quality of life in patients waiting for major joint replacement. A comparison between patients and population controls" pot
... (54 .1) 36 (27 .1) 25 (18 .8) 39 ( 29. 3) 45 (33 .8) 71 ( 53. 4) 39 ( 29. 3) 23 (17 .3) 40 (30 .3) 61 (47 .3) 38 ( 59. 4) 18 (28 .1) (12 . 5) 29 (47.5) 23 (37 .7) 0.862 0.027 0.2 29 0. 014 0.600 0.066 17 (12 . 8) 11 2 ... 0.6 13 21 . 430 *** 13 3 P value 0 .38 1 0.286 0.020 0. 232
- 7
- 447
- 0
báo cáo hóa học:" Health-related quality of life in relapsing remitting multiple sclerosis patients during treatment with glatiramer acetate: a prospective, observational, international, multi-centre study" pdf
... 22 . 31 19 . 45; 21. 51 Mean (SD) 20 .94 (4. 69) 21. 73 (4.76) 19 . 98 (4 . 43) Median 21. 00 21. 50 20.00 95 % CI (mean) 20.25; 21. 63 20.78; 22. 69 19 . 00; 20 .96 Change B to M6 Mean (SD) Median 1. 41 (3 .97 )* 1. 00 ... (4.26) 19 . 47 (4 .12 ) Median 95 % CI (mean) 19 . 00 18 .92 ; 20 .10 20.00 18 .72; 20 .36 19 . 00 18 . 61; 20 .33 Mean (SD) 20 .95 (4. 63) 21 .35 (4. 63) 20.48 (4. 61) Median 21. 00 22.00 21. 00 95 % CI (mean) 20.26; 21 .65 ... (mean) 19 . 15 ; 20.54 17 .54; 19 . 79 18 .67; 20. 51 17. 41; 21. 29 Mean (SD) 1. 76 (4.25)* -0. 21 (3 . 91 ) 2.52 (4.72)* -0.06 (2 . 91 ) Median 1. 00 0.00 2.00 0.00 95 % CI (mean) 1. 05; 2.47 -1. 47; 1. 06 1. 49; 3. 56...
- 7
- 321
- 0
báo cáo hóa học:" Comparison of numerical and verbal rating scales to measure pain exacerbations in patients with chronic cancer pain" ppt
... Gagliese L: Assessment of pain in elderly people Handbook of pain assessment 20 01, 7 :1 19 - 13 3 21 Walsh D: Practical problems in pain measurements Pain 19 8 4, 19 ( 1) :96 -98 22 Jensen MP, Turner JA, ... and pain perception Pain 2002, 98 (1- 2):205- 216 31 Cleeland CS, Ryan KM: Pain assessment: global use of the Brief Pain Inventory Ann Acad Med Singapore 19 9 4, 23( 2) :1 29 - 13 8 32 Jensen MP: The validity ... measurement of clinical pain intensity: a comparison of six methods Pain 19 8 6, 27 (1) :11 7 -12 6 12 Jensen MP, Karoly P: Self-report scales and procedures for assessing pain in adults Handbook of pain...
- 8
- 462
- 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt
... Schizophrenia Trial of Aripiprazole: (STAR) study Eur Psychiatry 2007, 22 : 433 - 4 43 15 Barnes TR: A rating scale for drug-induced akathisia Bri J Psychiatry 19 8 9, 15 4:672-676 doi :10 .11 86 /17 44-859X -9- 11 Cite ... 34 : 13 7 -14 6 11 Narita N, Hashimoto K, Tomitaka S, Minabe Y: Interactions of selective serotonin reuptake inhibitors with subtypes of sigma receptors in rat brain Eur J Pharmacol 19 9 6, 30 7 :11 7 -1 19 ... article as: Furuse and Hashimoto: Fluvoxamine for aripiprazoleassociated akathisia in patients with schizophrenia: a potential role of sigma -1 receptors Annals of General Psychiatry 2 010 9: 11 ...
- 3
- 403
- 0
Báo cáo y học: "Switching from serotonin reuptake inhibitors to agomelatine in patients with refractory obsessive-compulsive disorder: a 3 month follow-up case series" doc
... Tijdschr Geneeskd 2002, 14 6: 297 - 299 Fornaro Annals of General Psychiatry 2 011 , 10 :5 http://www.annals-general-psychiatry.com/content /10 /1/ 5 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Kessler RC, ... 2007, 15 2: 29- 35 Akiskal HS, Akiskal KK, Haykal RF, Manning JS, Connor PD: TEMPS -A: progress towards validation of a self-rated clinical version of the Page of 26 27 28 29 30 31 32 33 34 35 36 37 38 ... touching holy pictures of saints in her pocket and continuative fear of cursing against God Both cognitive status and insight of illness (as measured by a BABS total score of 11 ) were maintained...
- 8
- 465
- 0
Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx
... Dec 19 9 3 - Jan 19 9 5 diarrhoea ZDV, 3TC Feb 19 9 5 - Jul 19 9 5 ZDV, 3TC, SQV Aug 19 9 5 - Feb 19 9 6 diarrhoea IDV, 3TC, ZDV Mar 19 9 6 - Apr 19 9 8 kidney stones d4T, EFV, NFV May 19 9 8 - Apr 19 9 9 psichiatric ... http://www.aidsrestherapy.com/content/8 /1 /9 Page of Table Therapeutic history of the patients Antiretroviral drugs Period of therapy ZDV Reasons for change 19 9 0 - 19 9 3 Case ddI May 19 9 3 - Oct 19 9 3 ddC ... Trend of HIV -1 RNA and ALT/AST levels Aminotransferase (AST and ALT) values and plasma HIV-RNA levels in the three patients before and after the beginning of an effective HAART Normalization of...
- 5
- 326
- 0
Báo cáo y học: "The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese cardiovascular center" ppt
... 0 .18 0.87 ± 0. 21 0.84 ± 0.20 1. 06 ± 0.67* AV 1. 19 ± 0 . 31 1. 67 ± 1 .12 * 1. 50 ± 0 .12 1. 26 ± 0.76 MV 1. 61 ± 0.40 1. 53 ± 0.48 1. 71 ± 0.52 1. 71 ± 0 .30 TVR 3. 47 ± 0. 79 3 .97 ± 0. 59* 3. 23 ± 1. 05 3. 38 ... underlying causes of chordae tendinae rupture: A systematic review Int J Cardiol 2 010 , 1 43( 2) :1 13 - 8 19 Pande S, Agarwal SK, Dhir U, Chaudhary A, Kumar S, Agarwal V: Pulmonary arterial hypertension in ... Circulation 2008, 11 8(7) :1 737 -47 11 Yuan S: Clinical significance of mitral leaflet flail Cardiology Journal (dawniej Folia Cardiologica) 20 09, 16 (2) :15 1-6 12 Sochowski RA, Chan KL, Ascah KJ, Bedard...
- 7
- 279
- 0
Báo cáo y học: " Perioperative infusion of low- dose of vasopressin for prevention and management of vasodilatory vasoplegic syndrome in patients undergoing coronary artery bypass grafting-A double-blind" potx
... CR, Edwards NM, Landry DW, Oz MC: Arginine vasopressin in the management of vasodilatory hypotension after cardiac transplantation J Heart Lung Transplant 19 9 9, 18 : 814 - 817 32 Tayama E, Ueda T, ... Operation’s-time (min) 238 ± 32 228 ± 26 0, 2 31 Cardiopulmonary bypass-time (min) Myocardial ischemia-time (min) 1 69 ± 29 52 ± 14 17 7 ± 20 47 ± 12 0,262 0 .18 2 Mean hypothermia (°C) 31 .4 ± 1. 8 31 .1 ... Norepinephrine was infused in a minimal dose of 0. 03- 0.05 μg/Kg/min in patients (24%) of group A and in 18 patients (72%) of group B (p = 0.002) Epinephrine infusion was additionally necessary in...
- 12
- 336
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25